Содержание

Стальные «фрики» | Историческая хроника | Новости

Не все танки одинаково полезны и эстетичны. В истории мирового танкостроения есть несколько десятков поистине странных «особей», отличающихся весьма экстравагантной внешностью и сомнительной функциональностью. Учись они в школе, им бы наверняка достались обидные прозвища и насмешки одноклассников. Впрочем, некоторым из них нелепая внешность не помешала снискать настоящую боевую славу. Несколько «белых ворон» середины XX века — в нашем обзоре.

Goliath

Этот немецкий танк обладал скромными габаритами и с виду напоминал детскую игрушку. Вместе с тем, он активно эксплуатировался армией Германии во время Второй мировой войны. Боевая гусеничная машина могла нести на себе до 100 килограммов взрывчатки и предназначалась для уничтожения танков, пехоты и разрушения зданий. Особенно активно «Голиафы» использовались немцами для ликвидации баррикад во время Варшавского восстания. Фактически, Goliath можно назвать передвижной миной.

Управление осуществлялось посредством дистанционного пульта. За танкеткой тянулся длинный провод, который делал конструкцию машины весьма уязвимой. При большом желании «Голиафа» мог вывести из строя любой «Давид», вооруженный кухонными ножницами.

MAUS

Этот легендарный танк не мог остаться для нас незамеченным, ведь он — один из самых крупных в истории мирового танкостроения. Масса в 180 тонн, «железобетонное» бронирование и мощнейшее орудие делали его практически неуязвимым бойцом на поле боя. Вместе с тем, исполинский вес создавал некоторые трудности в пересечении местности, в частности при преодолении мостов. Сложно даже представить себе, какие надежды на него возлагало командование Германии. Однако им не суждено было сбыться. К 1945 году было создано лишь два экземпляра «Мышонка». Обе машины были подорваны немцами при отступлении. Сегодня Maus, собранный из уцелевших частей двух опытных машин, хранится в бронетанковом музее в Кубинке.

Прыгающий танк Baker Manufacturing

Идею этого экспериментального танка американские конструкторы наверняка подсмотрели в природе. Все дело в том, что он обладал необычной способностью — прыгал, подобно кузнечику или другому насекомому. Четыре его пружины могли синхронно разжиматься, подбрасывая машину на высоту до 120 сантиметров. Таким образом, Baker Manufacturing мог легко преодолевать противотанковые рвы и перепрыгивать ежи. Несмотря на свои впечатляющие качества проходимости, танк так и не стал эффективной боевой единицей. Виной тому — уязвимая конструкция колес и подвески, которые легко можно было вывести из строя при помощи ручного автоматического оружия.

Объект 279

Этот тяжелый советский танк, напоминающий по форме НЛО, был разработан в Ленинграде в 1957 году. Машина предназначалась для прорыва плотной обороны противника и боевых действий на труднопроходимых участках местности. Благодаря сдвоенной паре широких гусениц, танк мог с легкостью пройти там, где другие «тяжеловесы» вязли по самую башню. Примечательна и его весьма необычная футуристичная внешность. Сложно себе представить, какое впечатление мог бы произвести «неопознанный летающий танк» на противника, если бы принимал участие в боевых действиях.

Впрочем, «космическая» боевая машина так и не была запущена в серийное производство — удачный проект тяжелого танка был по неизвестной причине отвергнут лично Н. Хрущевым. 

Kugelpanzer

Этот округлый предмет может смело претендовать на звание самого нелепого и таинственного танка в истории. Полное отсутствие вооружения и странная форма до сих пор вызывает споры в среде специалистов.

По одной из версий, эта немецкая самоходная машина предназначалась для артиллерийской корректировки. Находящийся внутри танкист мог подобраться вплотную к вражеским позициям и передать по рации необходимую информацию о расположении сил. При этом наблюдение осуществлялось через узкую щель в бронированном корпусе.

Однако более правдоподобной является версия, согласно которой этот экспериментальный образец был создан для демонстрации принципиальных возможностей аппаратов, построенных по принципу дицикла.

В настоящее время один экземпляр «бронированного шара» можно увидеть в бронетанковом музее в Кубинке.

Неуловимая «Мышь» | Warspot.ru

В годы Второй мировой войны Великобритания и СССР довольно активно обменивались данными о противнике. Из СССР

даже приходили трофеинапример, «Пантера» и Pz.Kpfw.III Ausf.L. Однако к концу войны отношения между союзниками серьёзно ухудшились, и обмен информацией прекратился. Изза того, что оба опытных танка «Маус» попали в руки Красной армии, британцам пришлось собирать информацию о них по крупицам на оккупированной территории. Как сработали британские
исследователи и насколько достоверную информацию им удалось собрать?

Последний писк

«Маус» впервые упоминается в технической разведсводке директора Королевского танкового корпуса (DRAC — Director of Royal Armoured Corps) за май 1945 года. В сводке машина описана довольно лаконично:

«В последнее время немцы в основном разрабатывают сверхтяжёлые танки. Три таких машины было исследовано: … «Маус» («Мышь»): танк, вес примерно 200 тонн, с пушкой 12.8 cm KwK 82 (L/55) и спаренной 7.

5 cm KwK 44 (L/36.5) в башне с круговым обстрелом»

Также в этой сводке описывались Е-100 и «Грилле», найденные на полигоне фирмы «Хеншель», но информации и об этих машинах было мало.

Офицеры 1-й польской бронетанковой бригады и три комплекта бронедеталей от «Мауса», полигон Круппа в Меппене

Ждать дополнительной информации о машинах пришлось недолго. В мае на полигоне Круппа в Меппене обнаружили три корпуса и три башни «Мауса». Они были пустыми, но установка 128-мм и 75-мм орудий, найденная рядом, позволяла предположить, что она принадлежит тому же танку. Найденные документы помогли разобраться, что пушка раньше называлась 12.8 cm KwK 44 (Maus), но затем её переименовали в 12.8 cm KwK 82. Документы также поведали, что танк не был серийным и всего произведено не более шести корпусов и башен. Три комплекта, найденные на полигоне, доставили туда для испытаний обстрелом. Пушка «Мауса» также была опытной и приехала в Меппен в ноябре 1943 года для испытаний.

Этикетка на ящике со снарядами для неё датировалась 3 января 1944 года.

В докладе сообщалось, что конструкция корпусов и башен отличается от последних немецких машин: листы соединялись в замок, а количество листов, расположенных под углом, оставалось минимальным. Также отмечалось, что танк фактически имеет двойной борт, так как бортовые листы подкрылка опускались ниже пола боевого отделения.

Двигатель находился не сзади, как обычно, а посередине танка, между боевым отделением и отделением управления. Трансмиссионный отсек остался сзади. Агрегатов в корпусе не обнаружили, но автор доклада выразил мнение, что трансмиссия была электрическая, как на самоходке «Элефант».

Данные по бронированию «Мауса», полученные британцами. Некоторые измерения являются ориентировочными

Взвесить и измерить найденные детали до написания доклада британцы не успели, но вес башни составлял, по их оценкам, примерно 34 тонны, а весь танк весил порядка 200 тонн. Данные по габаритам корпуса, башни и траков тоже были ориентировочными.

Британцы торопились получить информацию о неизвестном танке, и в спешке не очень тщательно проверяли полученные данные, расспрашивая кого попало. Например, источником первых докладов стал инженер, работавший на полигоне. Имелся один нюанс: он не работал не только с «Маусом», но и с танками вообще. Специальностью инженера был бетон, и он обустраивал для «Мауса» испытательную полосу подводного вождения. Всё, что этот человек сообщил о танке, он знал понаслышке, поэтому не приходится удивляться, что информация оказалось довольно неточной.

По мнению источника, работы над проектом начали ещё весной или летом 1942 года при поддержке министра военной промышленности Шпеера. Тогда танк якобы назывался «Маммут» (Mammut — «Мамонт»). В 1943 году допрашиваемому инженеру поручили построить бассейн для подводного вождения, который мог бы выдержать 200-тонного исполина. Это было довольно интересное задание, так как масса танка, именовавшегося «Мойсхен» (Mäuschen — «Мышонок») тогда составляла всего 100 тонн.

Из разговоров с военными и другими инженерами специалист по бетону узнал, что в качестве двигателя новинка будет иметь дизельный MB 517 или бензиновый DB 603, электрическую трансмиссию, продольные торсионы по типу «Элефанта» и защиту от отравляющих веществ. Экипаж танка состоял из 6–7 человек.

По мнению инженера, один «Маус» построили и испытали в австрийском Линце, и он оставался там до конца войны. Что касается проекта в целом, тот он был закрыт Гитлером в начале 1944 года из-за запредельной стоимости машины и дефицита меди.

Допрашивался о «Маусе» и более авторитетный источник, но и он не смог дать точную информацию о проекте. Заведующий полигоном «Хеншеля» Курт Арнольд рассказал, что изначально танк должен был весить 150 тонн, но в итоге «набрал» примерно 200 тонн. «Маус» приводился в движение двумя 850–1000-сильными моторами, которые так и не довели до нужного уровня надёжности. Переброска машины на большие расстояния производилась только по железной дороге. Броня имела толщину 190–210 мм, дополнительные 90-мм экраны защищали ходовую часть. Заключение истории совпадало с версией инженера-бетонщика: проект закрыли в апреле 1944 года из-за технической сложности и неблагоприятного хода войны.

Не имея других источников информации, британцы продолжали обследование имеющихся деталей и узлов. Отмечалось, что широкие гусеницы машины сильно ограничивали заброневое пространство: расстояние между бортами составляло всего 1155 мм, при том, что между бортами подкрылков было 3645 мм. Это ограничивало высоту боевого отделения, так как пол подбашенной корзины не мог опускаться ниже пола подкрылков.

Всего корпус танка состоял из четырёх отсеков, отделённых друг от друга 20-мм бронированными перегородками. Отделение управления располагалось спереди. Как отмечалось выше, британцы не знали, сколько людей должно здесь находиться. В 100-мм крыше отделения был прорезан овальный люк размерами 900×380 мм. Перед ним имелось небольшое отверстие — предположительно, для перископа водителя, и ещё одно, совсем маленькое, предположительно для вентилятора. В полу отделения имелось круглое отверстие эвакуационного люка диаметром 520 мм.

Схема компоновки «Мауса». Обращает на себя внимание изобилие вопросительных знаков

За отделением водителя следовало моторное отделение. Крыша над ним отсутствовала, но британцы полагали, что броня имела толщину 60 мм. Предположительно, двигатель монтировался посередине отделения, а в подкрылках располагались бензобаки. Моторное отделение было разделено на шесть частей, но догадаться, для чего, не удалось.

За моторным отделением шло боевое. Его крыша состояла из четырёх деталей 60-мм толщины, сваренных вместе. Отделение оказалось пустым, и потому о нём сложно было что-либо сказать. Наконец, в корме располагалось трансмиссионное отделение, тоже пустое, которое 20-мм бронированными перегородками разбивалось на три части. Автор доклада предположил, что здесь могла находиться электрическая трансмиссия, о которой рассказывал инженер.

Измерив габариты корпуса, британские специалисты посчитали, что он должен весить порядка 68 тонн.

Башня описывалась как «массивная конструкция, чрезвычайно высокая для своей ширины и длины». Её массу без каких-либо агрегатов оценили в 34 тонны. Из-за округлого лба башню сравнили с башнями «Королевских Тигров», причём в докладе авторство этих башен ошибочно приписывалось доктору Порше. Во лбу башни было прорезано отверстие для орудийной установки, смещённое вправо от продольной плоскости симметрии башни примерно на 200 мм. Оно позволяло оценить габариты маски пушки, не имея её в наличии. Днище башни толщиной 93 мм состояло из двух деталей, имея местные ослабления. На крыше башни обнаружилось круглое отверстие диаметром 35 см, другое отверстие диаметром 25 см имелось в корме. Ни то, ни другое не годились для люка, и автор доклада решил, что башни и корпуса до отбытия в Меппен попросту не прошли полную обработку.

Схема известных деталей «Мауса» на конец мая 1945 года в сборке. О конструкции ходовой части и маски пушки британцы не имели вообще никакой информации

Броня танка полностью была катаной. Измерение толщины таких огромных плит оказалось сложным, но числа, полученные британцами, не сильно отличались от данных замеров, произведённых советскими инженерами.

Орудия, предназначенные для «Мауса», исследовали отдельно. Дульный тормоз у 12.8 cm KwK 82 L/55 отсутствовал, но автор доклада не исключал возможности находки стволов с нарезкой под дульный тормоз в будущем. Клиновой горизонтальный казённик открывался вправо. Для стрельбы использовался стандартный электрический спусковой механизм. В спаренной установке пушка главного калибра находилась слева. Чтобы уравновесить установку, орудие сместили довольно далеко назад. Тормоз отката и накатник располагались над стволом. Длина орудия составляла 7020 мм, длина нарезной части — 5533 мм. По расчётам, снаряд 12.8 cm PzGr 43 весом 28,3 кг вылетал из пушки со скоростью 750 м/c со средним зарядом или 920 м/с — с полным.

«Маус» на той же схеме, что и на предыдущем рисунке, вид сверху

Спаренная с 128-мм орудием пушка 7.5 cm KwK 44 L/36.5 была полностью новой конструкцией, хотя автор не исключал возможности использования патронов от 7.5 cm KwK L/24. Пушка тоже имела клиновый горизонтальный затвор, открывающийся вправо, и электрический спусковой механизм. Пушка помещалась справа от главного орудия и при полном откате могла заблокировать его затвор. Тормоз отката находился снизу ствола, а накатник сверху. Люлька обоих орудий была выполнена единой литой деталью. Она крепилась ко лбу башни с помощью выступа в своей передней части. По расчётам британцев, вес обоих орудий и люльки составлял не менее 5 тонн.

Используя соотношения веса бронирования и остальных агрегатов известных им танков, британские специалисты пришли к выводу, что полностью комплектный «Маус» должен весить около 214 тонн.

На изучении корпусов, башен и орудий исследователям пришлось остановиться. Больше никаких материалов не нашлось, а «Маус» во многом всё ещё оставался загадкой. 27 июня 1945 года вышел доклад о танке, но он содержал в основном информацию, собранную в мае, дословно включая показания инженера с полигона. Дополнительно сообщалось, что танк, вероятно, сначала имел двигатель DB 603, но позже его заменили на MB 517. Также в доклад попали некоторые новые данные о трансмиссии. Обновились данные по весу машины: оказалось, что она весила не 214, а «всего лишь» 176,5 тонн.

По горячим следам

К осени британцам удалось собрать данные, которые во многом помогли разъяснить ситуацию. Приложение к технической разведсводке №186 от 11 октября 1945 года содержало пересказ беседы между Порше, Гитлером и Шпеером, состоявшейся 8 июня 1942 года. После обсуждения вопроса установки 71-калиберного 88-мм орудия в танк Tiger (P) речь пошла о машине со 128-мм или 150-мм орудием во вращающейся башне, спаренным с 75-мм орудием, или самоходки, вооружённой 180-мм пушкой с бронёй толщиной 200 мм спереди и 180 мм по бортам. Бронирование башни или рубки тоже предполагалось внушительным: 220 мм в лобовой части и 200 мм по бортам. Для такой машины Порше рекомендовал использовать дизельный двигатель, но Шпеер высказался против, аргументируя это тем, что времени на разработку подобного дизеля просто нет.

Схема двигателя «Даймлер-Бенц» MB 509

Дальше следовал пересказ истории разработки «Мауса». Порше и его специалист по электротрансмиссиям Отто Цадник решили вновь применить идею, воплощённую на «Фердинанде», но с довольно серьёзными переделками. Вопреки Шпееру, Порше решил всё-таки использовать дизельный двигатель, но тут подвела компания «Даймлер-Бенц»: в ноябре Порше узнал, что получить двигатель в срок не получится. Порше пришлось смириться с использованием бензинового MB 509 (в документе он назван DB 509), из-за чего пришлось слегка изменить конструкцию трансмиссии.

Под конец 1942 года Управление вооружений приставило к проекту куратора в лице полковника Хенеля. Его обязанности заключались в поездках по фирмам-субподрядчикам с угрозами штрафами и наказаниями за невыполнение плана. Например, 13 декабря 1942 года Хенель объявился в Штутгарте и приказал, чтобы корпус «Мауса» был готов к испытаниям к 5 мая 1943 года. Указания не имели никакого эффекта, и визиты полковника относили к категории забавных происшествий.

Общая схема танка «Маус»

В начале января 1943 года Порше вызвали в Берлин для показа модели танка Гитлеру. Она понравилась фюреру, но каких-либо конкретных замечаний или комментариев тот не сделал.

К 12 января работы по танку разделили следующим образом: башней и корпусом занимался концерн Круппа, мотором — «Даймлер-Бенц», электрическими агрегатами — «Сименс-Шуккерт», подвеской и ходовой частью — «Шкода». Окончательная сборка предполагалась на заводе «Алкетт».

Работа началась, но бурные дискуссии вокруг проекта продолжалась. Генрих Книпкамп, например, категорически возражал против такой разработки, заявив, что конструкция получится слишком ненадёжной. Полковник Хенель, наоборот, пытался добиться дополнительных бонусов, заявляя, что машине обязательно надо иметь огнемёт с 1000-литровым баком. После проведения соответствующих расчётов полковника пришлось огорчить: установка огнемёта сделала бы и без того тяжёлый танк ещё тяжелее, и под него пришлось бы переделывать не только установку вооружения, но и подвеску. В то время, как в передовых конструкциях использовали торсионную подвеску, Порше не желал рисковать и заказал у «Шкоды» довольно простой вариант с тележками на спиральных пружинах.

Тележка подвески и гусеница

К концу февраля в Штутгартском техническом университете под руководством профессора Камма тестировали систему охлаждения, работу которой признали удовлетворительной.

Работа кипела. 6 апреля 1943 года в Штутгарт приехал Шпеер, который в течение получаса рассматривал макет гиганта. 10 апреля пришёл приказ на перевозку макета для показа Гитлеру, но 16 апреля его отменили. 14 мая фюрер всё же смог лично ознакомиться с обликом сверхтяжёлого танка. Увидев полноразмерный макет, он сделал странное замечание: по его мнению, «Маус» был похож на детскую игрушку. Гитлер приказал установить на машину 150-мм орудие, сохранив спаренную 75-мм пушку. Здесь автор доклада выразил сомнение, что Гитлер отдал бы такой приказ чисто из эстетических соображений, но спорить с фактом существования наработок установки для 150-мм пушки было сложно.

Гусеничный трак «Мауса»

16 июля двигатель MB 509 прибыл в Штутгарт для испытаний совместно с системой охлаждения. По всем сведениям, конверсия двигателя из авиационного в танковый проблем не вызвала, но уже на этой стадии проекта решили собрать второй прототип «Мауса» с морским дизелем MB 517.

Казалось бы, реализация проекта идёт хорошо. Фирма «Алкетт» 1 августа 1943 года начала сборку первого прототипа, когда пришли нерадостные новости: из-за сильных бомбёжек «Крупп» оказался не в силах в срок выполнить свою часть работ. К середине сентября первый корпус «Мауса» всё-таки закончили, но осень 1943 года стала для танка роковой: 27 октября на встрече с Порше в Берлине Шпеер объявил, что серийного производства не будет. Тем не менее, работа на танках «Маус» I с бензиновым MB 509 и «Маус» II с дизельным MB 517 продолжалась.

Американский солдат на заводе Круппа снимает размеры с корпуса «Мауса». Бомбёжка заводов, ответственных за производство деталей этого танка, похоронила проект

«Маус» (в докладе версия не обозначена, но это был первый вариант) поступил на испытания 23 декабря 1943 года. Так как башня ещё не поступила, вместо неё установили массогабаритный макет весом 55 тонн. Во время испытаний ломались пружины подвески, из-за низкого качества металла быстро ржавели патрубки, наблюдались проблемы с электрической трансмиссией. Тем не менее, результаты посчитали успешными, и танк послали в Бёблинген для более масштабных испытаний.

С Отто Цадником за рычагами танк показал себя с лучшей стороны. Очевидцы заявляли, что машина, прибывшая на полигон 10 января 1944 года, выполняла все манёвры, на которые была способна «Пантера». Это, естественно, не касалось скорости: на твёрдой поверхности колосс мог разогнаться лишь до 22 км/час. В итоге Гитлер приказал к июню поставить на «Маус» настоящую башню.

Схема башни «Мауса», собранной в металле (слева), и концепция башни с дальномером (справа)

Башня прибыла 3 мая. Пушки, поворотный механизм и другие агрегаты поступили несколько дней спустя, и сборка башни закончилась к 9 июня. После её установки на танк повторные испытания показали, что динамика «Мауса» улучшилась, так как башня весила немного меньше 55-тонного макета. Танк остался в Бёблингине до начала октября 1944 года, когда поступил приказ послать машину в Куммерсдорф.

Тем временем, продолжались работы и над вариантом «Маус» II. Машина прибыла в Бёблинген 20 марта 1944 года, но двигатель изготовили только в сентябре. Его испытания на стенде показали многообещающие результаты. В начале октября двигатель прибыл в Бёблинген, его поставили на танк и сразу же, без каких-либо испытаний, послали его в Куммерсдорф. Это оказалось ошибкой: как только в Куммерсдорфе «Маус» завели, сломался карданный вал — вероятно, из-за низкого качества сборки. Двигатель разболтался в пути, что привело к его смещению и последующей аварии.

Корпус «Мауса» на заводе Круппа

Новый MB 517 прибыл в Куммерсдорф только в марте 1945 года. Команда техников, которую послал Порше, вернулась в Штутгарт 3 апреля. По их словам, двигатель успешно завели, но танк с места не сдвинулся. Насколько стало известно британцам, на момент окончания боевых действий оба гиганта всё ещё оставались в Куммерсдорфе.

Вежливые беседы

Так как Куммерсдорф оказался в советской оккупационной зоне, у британцев не было никаких шансов получить для испытаний один из «Маусов». Тем не менее, на территории под контролем западных Союзников остались заводы и специалисты, которые были связаны с созданием гигантского танка.

Башня «Мауса» на заводе Круппа

Опросы сотрудников Круппа в Эссене и исследование частично собранных корпусов в цеху дали много информации о проекте. По словам немцев, корпус и башня были разработаны Круппом в июне 1942 года, а к производству приступили в мае 1943 года. В докладе BIOS (British Intelligence Objectives Sub-Committee — Подкомитет британской разведки по целям) о методах сборки корпусов и башен на немецких заводах приводились довольно неточные данные о «Маусе»: хотя толщина брони и занижена, масса самого оценена как «примерно 200 тонн». По сведениям, собранным на заводе, Крупп произвёл три комплекта брони. Один отослали на испытания обстрелом, два других остались на заводе.

При работе совместно с американцами британцам повезло больше. Доклад CIOS (Combined Intelligence Objectives Sub-Committee — Совместный подкомитет по разведке целей) о работе доктора Порше во время войны дал огромный массив информации о танке. Сотрудникам разведки удалось не только раздобыть информацию о «Маусе», но и его чертежи.

Продольный разрез. Несмотря на колоссальный объём машины, свободного пространства внутри было мало

Опрос самого Порше раскрыл интересный факт. Конструктор рассказал о двух собранных «Маусах», но, по его мнению, танк приняли в производство. В докладе отмечалось, что Шпеер, Хайдекамп и другие высокопоставленные лица с таким мнением согласны не были. Порше описал своё детище как «подвижный бункер», но автор доклада добавил примечание, что несколько «Тигров» или «Пантер», стоившие вместе как один «Маус», были бы гораздо более полезны даже в оборонительных целях.

Эпитет «подвижный бункер» довольно точно описывал задачу, которую поставили Порше. При эквивалентной 350-мм лобовой броне скорость машины должна была составить всего 20 км/час. Это существенно упростило конструкцию подвески. Для предотвращения потери дорогой машины на минах танк предстояло хорошо защитить и снизу. Для перевозки будущего «Мауса» по железной дороге требовалось разработать специальную платформу.

Схема подвески «Мауса»

Так как мостов, способных выдержать такую махину, было мало, требовалась способность подводного хода при глубине брода до 7–9 метров. Механизм, разработанный немцами, описывался как «оригинальный, но не очень практичный». Из-за того, что танк не мог развить полную мощность двигателя при подаче воздуха через шланг, конструкторы пошли другим путём. Один «Маус» оставался на берегу, и ток от его генератора подавался к другому «Маусу», который пересекал водную преграду. После выхода машины на другой берег танки менялись ролями, и первый совершал переход с помощью тока от второго. Подготовка к такой процедуре занимала порядка 45 минут, и для этого экипажам надо было покинуть машины. Также оба берега требовалось тщательно приготовить к переправе таких тяжёлых танков. Так как «Маус» должен был воевать при постоянном сопровождении других танков, этот метод признали допустимым. По словам специалистов, исследовавших конструкцию люков, шансы спастись при поломке водой имелись только у водителя и радиста.

От Порше британцы получили точный вес не только всего танка (184,4 тонны), но и различных его агрегатов. Так, 41,8% массы «Мауса» приходилось на бронирование. Для сравнения, у «Черчилля» III этот параметр составлял 40,7%, а у «Кромвеля» — 34,7%. На подвеску и ходовую часть приходилось всего 16,0% по сравнению с 21,0% и 25,7% соответственно. Из-за довольно громоздкой электрической трансмиссии вес этого агрегата у «Мауса» был вполне сопоставим с британскими танками: 7,9%, 7,0%, и 7,4% соответственно.

Схема устройства частично механизированной боеукладки в нише башни

Доля мощного вооружения немецкого исполина оказалась внушительнее, чем у британских машин: 27,5% против 14,3% и 19,3%. Всего на башню, вооружение и снаряды пришлось примерно 50 тонн, что делало работу механизма поворота башни сложной, особенно с учётом предположения, что она должна быть плохо уравновешена. Стало очевидно, что конструкторы уделили первостепенное внимание вооружению и бронированию, а остальные агрегаты оказались второстепенными.

Так как фирма Порше не была связана с разработкой орудийной установки напрямую, при обсуждении вооружения он сделал несколько ошибок. Например, автор писал, что спаренная 75-мм пушка идентична той, что раньше использовали на Pz.Kpfw.IV. Порше упомянул, что главное орудие в будущем могли заменить 150-мм 38-калиберной пушкой, но более точной информацией он не владел. Длина отката 128-мм 55-калиберной пушки составляла примерно 960 мм. Пушка была уравновешена с помощью противовеса. По мнению Порше, из-за недостатка места в башне пулемёты установили не лучшим образом, но для разработки лучшей установки не оставалось времени.

Схема основных боеукладок в корпусе. Вопрос о том, как танкисты должны были извлекать из них огромные унитарные патроны и заполнять боеукладку первой очереди, остаётся открытым

Так как справиться с 56-килограммовыми 128-мм или 70-килограммовыми 150-мм снарядами вручную было невозможно, особенно в унитарных патронах, для «Мауса» разработали механизм заряжания, но даже с ним требовалось посадить в башню двух заряжающих. Предполагалось, что в случае установки 150-мм пушки пришлось бы перейти на раздельное заряжание. Предполагалось, что в танке поместится, по разным данным, 60 или 68 снарядов для 128-мм пушки и 200 снарядов для 75-мм пушки. Количество 150-мм снарядов осталось неизвестным. Про прицел Порше ничего не знал, но рассказал, что имелись планы установить дальномер.

В руки англо-американской комиссии попали и результаты испытаний. «Маус» мог преодолеть вертикальную стенку высотой 0,72 метра и ров шириной 4,5 метра, а радиус действия машины с учётом топлива во внешнем баке достигал 190 км при скорости 16 км/час. Охлаждение двигателя имело острую проблему: на вентиляторы отбиралось целых 148 л.с., но даже при такой мощности силовая установка «Мауса» перегревалась после 15 минут работы на максимальном режиме.

Схема танка «Маус» с расчётом давления на опорные катки

«Маус» был неповторимой машиной. Конструируя свой «подвижный бункер», Фердинанд Порше применил множество уникальных конструкторских решений — как сомнительных, так и гениальных. Тем не менее, после войны работой Порше победители не заинтересовались. К концу 1945 года у американцев и британцев уже был опыт создания тихоходных тяжелобронированных исполинов, и ничего хорошего из этого не вышло. Хотя «Маус» оказался новинкой для англо-американской разведки, конструкция машины базировалась на технических решениях 1942–1943 гг., и таким танком восхищаться было уже поздно.


Источники и литература:

  1. Report of Investigation into the War Time Activities of Dr. Ing. h.c. F. Porsche, K.G.
  2. BIOS Final Report №614, Item №18, Welding Design & Fabrication of German Tank Hulls & Turrets
  3. CIOS Evaluation Report #244 — Henschel Tank Proving Grounds
  4. Архив Canadian Military Headquarters, London (1939-1947) RG 24 C 2
  5. Ю. И. Пашолок, И.Г. Желтов. Panzerkampfwagen Maus — М.: «Tactical Press», 2012

5 самых провальных танков XX века — журнал За рулем

Говорить о лучших всегда просто и приятно. В случае с танками можно, к примеру, похвалить мощное орудие, броню, надежность или технологичность массового производства. Но на каждый удачный образец всегда найдется его откровенно плохой собрат.

1. Царь-танк — завязший мастодонт

Царь-танк (kem.kp.ru)

Царь-танк (kem.kp.ru)

Материалы по теме

Русские по праву славятся умением делать оружие. Но тот, кто много делает, по пути неизбежно совершит массу ошибок. Одной из них был «Царь-танк» — проект инженера Николая Лебеденко, созданный и воплощенный в металле в 1914–1915 годах. Его габариты и до сих пор никем не превзойдены — почти 18 метров в длину, 12 в ширину и 9 в высоту. Да и вес был немаленьким — 60 тонн.

Лебеденко смог пробиться к Николаю II и провел очень грамотную презентацию. Он подарил царю модель танка с пружинным двигателем. Маленький «Царь-танк» весело катался по полу и преодолевал препятствия в виде книг из монаршей библиотеки, что произвело на императора серьезное впечатление. Лебеденко получил деньги на проект.

Увы, реальная ценность танка была невысокой. Огромные, но легкие колеса со спицами должны были повысить проходимость. Но на деле они были крупной уязвимой мишенью, которая ко всему прочему еще и ограничивала сектора обстрела своему же экипажу. Сказалась и другая ахиллесова пята тогдашней отечественной промышленности — не было мощных двигателей. На танк поставили два «Майбаха» со сбитого германского дирижабля. Но даже их оказалось недостаточно, когда сравнительно маленький задний каток танка, на который приходилась большая часть массы, увяз в мягком грунте полигона. «Царь-танк» застрял капитально — сдвинуть с места его так и не удалось. Поэтому спустя несколько лет, в 1923 году он был просто разобран на лом.

2. Schneider CA1 — странное место для орудия

«Шнейдер» СА-1 (artstation.

com)

«Шнейдер» СА-1 (artstation.com)

Материалы по теме

Совершали ошибки не только отечественные инженеры. Неудачи были не настолько велики и показательны, как с «Царь-танком». Лишь потому, правда, что был поскромнее сам размах — позиционный кризис Великой войны нуждался в разрешении, и армии воюющих сторон требовали более практичных, массовых и быстрых решений.

Концепция танка СА1 французской фирмы Schneider стала зарождаться в умах создателей еще в конце 1914 года. Чтобы не усложнять разработку и производство, конструкторы взяли за основу тракторное гусеничное шасси. Это сыграло злую шутку — серьезно пострадала проходимость, которая была чуть ли не самым важным качеством для танка в ту пору. Те же знаменитые английские «ромбы», гусеницы которых шли вдоль всего корпуса, преодолевали траншеи лучше.

Еще одной проблемной Шнейдера было вооружение. Вернее даже, его расположение. Единственную пушку поместили у правого борта. Сектор обстрела оказался весьма скромным — всего 40 градусов. В результате для смены целей часто приходилось разворачивать весь танк, что в условиях окопной войны среди бесконечных траншей и воронок сильно мешало. Об удержании цели в рамках обстрела во время активного маневрирования речи и не шло. Schneider, кстати, мог бы стать намного лучше — в самом начале конструкторы планировали снабдить его башней, но фронт требовал танки как можно быстрее. В результате получился самый неудачный французский танк Первой мировой войны.

3. A7V — слепой квадратный сарай

A7V. В небоевых условиях большая часть экипажа из 18 человек предпочитала ездить на крыше — внутри адская жара и раскаленный металл (stephencurryone.org)

A7V. В небоевых условиях большая часть экипажа из 18 человек предпочитала ездить на крыше — внутри адская жара и раскаленный металл (stephencurryone.org)

Материалы по теме

К началу Второй мировой немцы успели придумать, отработать и реализовать новую концепцию применения танков. Но еще каких-то 20 лет назад сумрачный тевтонский гений и понятия не имел, что же делать с этими новомодными средствами ведения войны.

В попытке не отстать от англичан и французов в Германии разработали танк A7V — здоровенный параллелепипед длиной в 7,3, высотой в 3,3 и шириной в 3 метра и весом в 30 тонн. Машину построили на тракторном шасси той же конструкции, что и у Шнейдера. Но проходимость была еще хуже в силу массы, высоты (и следующего из нее центра тяжести) и отсутствия шнейдерского «корабельного носа», который облегчал преодоление воронок.

Также A7V был крайне неприятен в эксплуатации. Двигатели находились в одном отделении с экипажем, что доводило температуру внутри танка до 50–60 градусов. Это, правда, было свойственно большинству танков Первой мировой. Но тут еще прибавлялись огромные размеры, делающие машину любимой мишенью артиллеристов. И крайне плохой обзор мехвода: расположенный в небольшой возвышающейся рубке, он не видел практически ничего из-за верхней части корпуса собственного танка. Неудивительно, что построили их всего 20 штук — то есть, трофейных британских «ромбов» в кайзеровской армии все равно было больше.

4. Char 2C — большой парень со слабым ударом

Char 2C (pinterest.com)

Char 2C (pinterest.com)

Материалы по теме

Французы учились на своих ошибках. Тракторное шасси и орудия в спонсонах или рубках их больше не устраивали. И тогда они решили создать танки с башней и расположением гусениц, которое позволит успешно преодолевать траншеи и воронки. Так получился легкий FT-17, схема которого стала настолько успешной, что потом использовалась в большинстве танков мира. Обратной стороной этого процесса стала попытка создать тяжелый танк.

2С получился переростком. После «Царь-танка» это второй по размерам танк в мире. А вот по весу «француз» перещеголял «русского» — 75 тонн, не шутки! Проблема была только одна — к концу Первой мировой танк не успел. Но французы все равно построили партию в 10 монстров, которые совершенно устарели к началу Второй мировой. Одна 75-мм пушка и 4 пулемета — не этого в 40-х годах ожидалось от гиганта с такой массой.

Такие танки стали бы для неприятельской авиации идеальной мишенью — большой и неповоротливой. Но им не удалось побывать и в этой роли — когда перевозящий их эшелон попал в безвыходную ситуацию, танки были взорваны французами. По другой версии, их все-таки уничтожили Люфтваффе, но опять же не в бою, а на железнодорожных платформах.

5. Maus — самая большая в мире мышь

Maus в Кубинке (soldat.club)

Maus в Кубинке (soldat.club)

Материалы по теме

Этот красавец оказался самым тяжелым танком за всю историю человечества. Стремление германского командования получить максимально защищенный танк прорыва довело его до чудовищной массы в 188 тонн. Лобовая броня достигала впечатляющей по тем временам толщины — 200 миллиметров. И, что самое удивительное, «Мышь» при этом реально могла перемещаться. Более того, танк для своих размеров управлялся просто великолепно. Его спарка 128-мм и 75-мм орудий была крайне серьезным аргументом, а мощное бронирование поставило бы в тупик даже ИС-2 или американский SuperPershing.

Правда, в бою наш герой так и не поучаствовал — немцы успели изготовить пару прототипов, причем вооружен был только один из них.

Но применение «Мыши» само по себе представило бы одну сплошную проблему. Во-первых, его бы не выдержал практически никакой мост — что резко ограничивало применение танка в богатой реками Европе. Во-вторых, для гиганта не имелось достойных тягачей. Застрянь он в мягком грунте во время отступления (типичная картина для немцев во второй половине войны), и сверхтяжелый танк был бы навсегда потерян.

К тому же не будем забывать, что танк воюет не только с себе подобными — он участвует в общевойсковом бою. Средства разобраться с «Мышью» в нем — артиллерия и авиация — нашлись бы незамедлительно, особенно на завершающем этапе войны.

[Ответы разработчиков] Отвечаем на ваши вопросы — Новости

Свежая подборка ответов разработчиков на вопросы игроков о разработке игры. Отвечает продюсер Вячеслав Буланников (BVV_d).

Бронетехника

— В данный момент в игровом сообществе идет активное обсуждение судьбы Maus, многие игроки огорчены тем, что этот танк исчезнет из ветки прокачки. Много вопросов по поводу возможности его получения после выхода обновления 1.91, поскольку в дневнике было указано, что он, как и другие выводимые танки, станет акционным. Не могли бы вы прояснить эти моменты более подробно?

Мы внимательно следим за этим обсуждением, и хотели бы более подробно прояснить нашу позицию. Первое — это судьба «бумажной» или, если хотите, «проектной» техники. Данные танки и ЗСУ (Тигр 105, Пантера, ЗСУ на базе Пантеры) будут скрыты из ветки исследования, но останутся на аккаунтах игроков, у которых они уже есть; также эту технику смогут прокачать те, кто уже начал процесс её исследования. Мы не планируем возвращать эту технику в игру в любом виде, так как это противоречит самой причине её вывода из игры. Таким образом, у вас есть последняя возможность получить эту технику — начать её исследование до выхода следующего мажорного обновления, которое, согласно нашим планам, будет выпущено в начале осени. Также, помимо уже объявленных танков для замены выводимых машин, в будущем будут добавлены и другие, чтобы заполнить пробелы в этом диапазоне БР.

Второе — Маус. Причина его вывода из основной ветки исследования иная, нежели чем у других выводимых машин: танк был добавлен в игру в качестве необходимого «топ» танка в тех условиях, когда мы ограничивали исторический период техники 50 годами. В той ситуации мы считали ввод Мауса оправданным, поскольку это делало ветку исследования наземной техники Германии конкурентоспособной. Однако по мере расширения ветки исследования «вниз» и добавления послевоенных ОБТ, немецкая ветка получила танки, сравнимые с топами других наций, а в некоторых аспектах, возможно, даже превосходящие их. Маус же остался в пограничном состоянии: с одной стороны, его балансировка осложнена наличием почти кругового мощнейшего противоснарядного бронирования (в плане защиты от калиберных бронебойных снарядов), с другой же стороны — его низкой подвижностью. Опустить БР ниже текущего, как того требует статистика, довольно тяжело, поскольку тогда значительное число его новых противников не сможет его пробить, а оставить на текущем БР  означает регулярные встречи с танками с высокой подвижностью и снарядами, пробивающими его защиту на любой дистанции.

Маус будет скрыт и перенесён из основной ветки исследования к акционным и премиумным машинам. Благодаря этому он будет реже встречаться в боях, что, возможно, позволит нам в будущем балансировать его более свободно. Также мы планируем в дальнейшем открывать его для исследования на ограниченное время — на тех же условиях, что и скрываем (если начали его исследование, закончить его сможете в любое удобное время). Это будет происходить нечасто, но, как мы рассчитываем, регулярно — по крайней мере, один раз в год. Мы не планируем появление Мауса на Бирже War Thunder — танк останется ограниченно прокачиваемым.


— Планируется ли заполнить существенный провал в итальянской ветке наземной техники между БР 4.3, 4.7 и 6.0? Можно привести довольно много примеров техники, которая могла бы его заполнить.

Да, у нас есть планы по добавлению нескольких машин в этом диапазоне БР.


— После введения техники 7 ранга прошло уже несколько месяцев. На БР 10.0 попадает уже довольно много игроков на менее совершенных машинах. Для танков с БР 9.0-9.7 это вполне терпимо, но для более ранних машин уже труднее. Есть ли причина, которая не даёт вам ввести ступени БР 10.3 или 10.7?

Главная причина в том, что мы не считаем так называемую «декомпрессию» (увеличение разброса техники по рангам) положительным явлением. Одной из основных особенностей бронетехники 6 и 7 рангов, которая позволила нам легко ввести их, была конструкция бронезащиты, примерно одинаковая для всех таких машин: узкая фронтальная защита с уязвимыми зонами и ослабленные борта с кормой, пробить которые по силам даже для орудий конца 40-х годов. Именно это позволило допустить в один бой технику, годы выпуска которой существенно отличались.

Эта же особенность улучшает условия для матчинга на высоких рангах, куда, естественно, добирается меньше игроков, и снижает время ожидания сессий.

Незначительное на первый взгляд расширение Боевых рейтингов до 10.7 снизило бы количество уникальной техники в топовых боях сразу в 2 (!) раза, сделало бы бои менее разнообразными и создало бы ситуацию, при которой значение брони будет сведено к минимуму — поскольку друг с другом преимущественно встречались бы машины, снаряды которых справятся даже с лобовой бронёй оппонента. При этом для танков 1-2 послевоенных поколений мало что изменилось бы, так как значительно расширить диапазон БР невозможно (исходя из ограничений по созданию времени сессии), а «предтоповые» танки — такие как Леопард 2А4 или Т-64 — по-прежнему не будут иметь никаких проблем с поражением танков предыдущих поколений.

И вновь хотим напомнить: Боевой рейтинг не является характеристикой, по которой можно сравнивать эффективность техники. Так, самолёт и танк с одинаковым БР вовсе не обязательно равны друг другу по силам, но это точно означает, что они могут встретиться в одном бою и иметь шансы на победу.

В целом, нынешние рамки БР мы считаем подходящими для эффективной балансировки, а добавление новых ступеней может произойти только в случае крайней необходимости. Но мы не исключаем и такой ситуации.


— Проводятся ли какие-либо тесты или эксперименты с режимом «Противостояние» для наземной техники? Многие игроки хотели бы видеть карты большего размера, а локация наподобие Курска могла бы предоставить значительную свободу для расширения границ и ведения по-настоящему масштабной наземной войны.

Сейчас мы работаем с морскими режимами, в том числе и со сходными с Противостоянием, так как считаем, что для совместных корабельно-авиационных боёв такие режимы подходят больше. Возможно, в будущем мы и попробуем что-то подобное и для наземной техники.


— Существует ли в игре полноценная механика разрушения снарядов? Как известно, в реальности подкалиберные снаряды, попадая по цели и пробивая её, разрушаются на осколки, встречая внутри танка различные элементы и узлы. У нас же в игре подкалиберы не теряют скорость и не разрушаются, что способствует сквозному пробитию от лба до кормы, и заодно уничтожает ещё 1-2 танка, если те оказались на траектории.

Да, существует. Подкалиберные снаряды с твердосплавными сердечниками APCR/APDS разрушаются при соударении с преградой определённой толщины и на определённой скорости — таким образом, для этих снарядов могут стать непреодолимыми даже тонкостенные экраны. Для сплошных бронебойных снарядов и оперённых подкалиберных работает и снижение бронепробития и урона на каждой пройденной преграде. Однако сейчас в игре массивные внутренние модули, такие как казённая часть пушки, двигатель и трансмиссия, эмулируются достаточно упрощённо. Фактически есть только два параметра: толщина обшивки для нанесения урона самому модулю, а также «габарит» модуля — эквивалент толщины, защищающей от сквозного пробития. Мы планируем улучшить эту механику и использовать для таких внутренних модулей принцип «объёмной» брони, так что их эквивалентный габарит будет зависеть от траектории снаряда. Данное решение как сократит в некоторых ситуациях число сквозных пробитий всего танка, так и сместит точку источника вторичных осколков к точке выхода самого снаряда, что также сделает модель повреждений более реалистичной. Например, сейчас, если у снаряда при попадании в казённую часть орудия, хватает энергии для её сквозного пробития, то вторичные осколки будут образовываться из точки попадания, а конус осколков покроет почти всё боевое отделение; в новой же системе точка вылета вторичных осколков окажется с другой стороны казённой части пушки и осколки ударят в заднюю стенку башни, оставив экипаж невредимым.


— В игру вводится всё больше современной техники, но по геймплею она не сильно отличается от техники конца 40-х. Планируется ли ввод механики современных танков типа КОЭП, тепловизоров, СУО, систем оповещения об облучении лазером и т.п?

Во-первых, мы не полностью согласны с данным утверждением. По геймплею отличие заметно: бои на больших скоростях и дистанциях, стрельба с ходу, особенности защиты современных ОБТ, вертолёты, ПТУР и ЗРК. Также не стоит забывать и о системах постановки дымовых завес, которые фактически являются составным элементом некоторых КАЗ. Так что в игре уже сейчас довольно много механик современных танков, и мы также планируем добавлять новые. Ждите официальных анонсов и Дневников разработки.


— Возможно ли появление бронеавтомобилей и бронированных грузовиков на высоких рангах: «Хаммеры», багги, УАЗы, Тойоты и т.д., которые исторически оснащались вооружением, способным поражать бронетехнику?

Да, у нас уже есть в работе машины такого типа. -образный (перевернутый), четырехтактный, жидкостного охлаждения; мощность — 1750 л.с. (1288 кВт) при 2700 об. в мин.; рабочий объем — 44500 куб.см. Трансмиссия: электромеханическая — два главных генератора, два тяговых электродвигателя, два механических агрегата-гитары с бортовыми тормозами, две бортовые передачи.  

На «Маусе» был установлен модифицированный авиационный двигатель фирмы Даймлер-Бенц DB-603A2 (иногда именуемый MB 509), 12-ти цилиндровый, Л-образный, с непосредственным вспрыском бензина в цилиндры и электрическим зажиганием. 

Он приводил в движение два электрогенератора, которые вырабатывали ток для тяговых электродвигателей. DB-603 работал по четырехтактному циклу, аналогично карбюраторному, отличаясь тем, что образование рабочей смеси происходило не в карбюраторе, а внутри цилиндров. Основным отличием этого двигателя от авиационного стало применение нового трехшестеренчатого редуктора, понизившего высоту оси ведущего вала и удлинившего двигатель на 250 мм. По сравнению с карбюраторными двигателями, DB-603A2 был более экономичным и менее пожароопасным и «чувствительным» к сорту топлива. Для охлаждения силовой установки использовались двухступенчатые вентиляторы. Практиковалось также жидкостное охлаждение выхлопных коллекторов. К одному из недостатков DB-603A2 относили затрудненный доступ к ряду агрегатов, расположенных а развале цилиндров (топливный насос, форсунки и др.).Электромеханическая трансмиссия танка «Маус» состояла из двух параллельно работающих электроприводов левой и правой гусеницы. 

Электрическая часть трансмиссии представляла собой две независимые друг от друга системы, обеспечивающие передачу крутящего момента от коленчатого вала двигателя к ведущим колесам.Два главных генератора, питающие током тяговые электродвигатели, размещались в моторном отделении. В блоке с главными генераторами находился вспомогательный генератор. Передний (по ходу танка) генератор обеспечивал питанием левый тяговый электродвигатель, задний — правый.    Вспомогательный генератор служил для питания обмоток обоих главных генераторов и тяговых электродвигателей. В момент запуска основного двигателя он использовался как электростартер, заряжаясь от аккумуляторной батареи. 

Тяговые электродвигатели (по одному на гусеницу) стояли в кормовой части корпуса. Крутящий момент с вала электродвигателя через двухступенчатый редуктор передавался на ведущее колесо.При движении под водой машина получала электроэнергию с генераторов другого «Мауса», находящегося на берегу. Передача осуществлялась через кабели. Управление танком при этом производилось из машины, подающей энергию, и ограничивалось только изменением скорости. 
  Механическая часть трансмиссии состояла из двух наклонных редукторов-гитар (на один борт) с тормозом и бортовой передачей. Они включались в силовую цепь последовательно за электромоторами. 

При изучении «Мауса» наши специалисты отмечали: «Заслуживает внимания доводка узлов и деталей [трансмиссии]. Выделяется стремление к облегчению условий работы деталей путем конструктивной отработки их и тщательного изготовления. Это позволило … повысить надежность агрегатов…». 

Источники: 
1. http://www.kithobbyist.com/AFVInteriors/ 
2. Сайт Александра Питолина

Тяжелый танк маус. Немецкий сверхтяжёлый танк Маус. Зоны пробития Мауса

Обратите внимание: сдаваемый танк принимается за половину от своей стоимости. Округление идёт в большую сторону.

Пример: вы хотите новый премиум танк за 10 000 . В обмен хотите сдать машину, которая в чистом виде стоит 5000 . По механизму trade-in старый танк будет зачтён за 2500 , и вы доплатите всего 7500 за новый танк. Итого скидка на новый танк в этом примере составит 2500 .

Выберите танк… M4A3E8 Fury Т-34-85 Rudy Т-34-85М СУ-100Y Pz.Kpfw. IV Schmalturm Dicker Max Type 64 AC 4 Experimental Cromwell B TOG II* Heavy Tank No. VI Škoda T 40 Strv m/42-57 Alt A. 2 M4A3E8 Thunderbolt VII Tiger 131 Pudel КВ-122 T23E3 ИС-2 Krupp-Steyr Waffenträger ИСУ-122С СУ-122-44 Panther/M10 VK 45.03 E 25 T28 Concept M56 Scorpion Type 62 AMX 13 57 GF FV201 (A45) AT 15A Т-54 первый образец WZ-111 M6A2E1 Type 59 T26E5 ИС-6 ИС-3 с М3 ИС-5 КВ-5 leKpz M 41 90 mm GF Panther mit 8,8 cm L/71 Panzer 58 Mutz Löwe Rheinmetall Skorpion G 8,8 cm Pak 43 Jagdtiger T95E2 M46 Patton KR T26E4 SuperPershing T34 B T34 T-34-3 59-Patton 112 M4A1 Revalorisé AMX Chasseur de chars AMX M4 mle. 49 FCM 50 t FV4202 STA-2 Lorraine 40t T25 Pilot Strv S1 Объект 252У Объект 252У Защитник Chrysler K GF Primo Victoria WZ-120-1G FT СТГ СТГ Гвардеец AMX Canon d»assaut 105 Выберите танк… Type 64 Heavy Tank No. VI Škoda T 40 Strv m/42-57 Alt A.2 СУ-100Y Dicker Max Pudel AT 15A Panther/M10 Krupp-Steyr Waffenträger VK 45.03 СУ-122-44 Löwe T26E4 SuperPershing FCM 50 t T-34-3 ИС-6 T34 Panther mit 8,8 cm L/71 AMX Chasseur de chars STA-2 Т-54 первый образец M4A1 Revalorisé FV4202 (P) 112 Strv S1 WZ-120-1G FT

Нужно доплатить:

Проходящие в игре скидочные акции влияют на стоимость сдаваемого и покупаемого танка — это будет наглядно отображено в окне обмена.

Что касается описанных на изображении выше правил обмена, система сама подскажет, какие танки можно сдать.

Какой танк я могу купить по trade-in?

Обмену подлежат многие премиум танки с VI по VIII уровень, но с важной оговоркой: сдать можно только премиум танк равного или низшего уровня по сравнению с покупаемым.

Trade-in снова с вами! С 6 февраля с выходом обновления 9.22 и до 20 февраля 9:00 (МСК) приобретайте премиум танки, сдавая неиспользуемые/неинтересные в зачёт!

Что нового?
Появились новые машины, которые можно приобрести по программе трейд-ин:
VIII Panzer 58 Mutz
VIII 8,8 cm Pak 43 Jagdtiger
VIII M46 Patton KR
VII M56 Scorpion
VIII AMX M4 mle. 49
VI AC 4 Experimental
И не забывайте главное: trade-in — отличная возможность купить проверенные временем танки с серьёзной скидкой.

Правила обмена
Обратите внимание: сдаваемый танк принимается за половину от своей стоимости. Округление идёт в большую сторону.


Пример: вы хотите новый премиум танк за 10 000. В обмен хотите сдать машину, которая в чистом виде стоит 5000. По механизму trade-in старый танк будет зачтён за 2500, и вы доплатите всего 7500 за новый танк. Итого скидка на новый танк в этом примере составит 2500.

Проходящие в игре скидочные акции влияют на стоимость сдаваемого и покупаемого танка — это будет наглядно отображено в окне обмена.

Что касается описанных на изображении выше правил обмена, система сама подскажет, какие танки можно сдать.

Какой танк я могу купить по trade-in?
Обмену подлежат многие премиум танки с VI по VIII уровень, но с важной оговоркой: сдать можно только премиум танк равного или низшего уровня по сравнению с покупаемым.

Какие танки МОЖНО ПРИОБРЕСТИ

VI уровень
VI СУ-100Y
VI Dicker Max
VI AC 4 Experimental
VI Type 64
VI Heavy Tank No. VI
VI Škoda T 40
VI Strv m/42-57 Alt A.2
VI Pudel
VII уровень
VII СУ-122-44
VII Panther/M10
VII VK 45. 03
VII Krupp-Steyr Waffenträger
VII M56 Scorpion
VII AT 15A
VIII уровень
VIII Т-54 первый образец
VIII ИС-6
VIII Panther mit 8,8 cm L/71
VIII Panzer 58 Mutz
VIII T26E4 SuperPershing
VIII Löwe
VIII 8,8 cm Pak 43 Jagdtiger
VIII M46 Patton KR
VIII T34
VIII AMX Chasseur de chars
VIII M4A1 Revalorisé
VIII AMX M4 mle. 49
VIII FV4202
VIII T-34-3
VIII 112
VIII WZ-120-1G FT
VIII STA-2
VIII Strv S1

Какие танки и за сколько МОЖНО СДАТЬ

VI уровень
VI М4-А2 Шерман Лозы — 1 850
VI Т-34-85М — 1 875
VI Т-34-85 Rudy — 1 775
VI СУ-100Y — 1 625
VI Pz.Kpfw. IV Schmalturm — 1 875
VI Tiger 131 — 1 950
VI Dicker Max — 1 600
VI M4A3E8 Fury — 1 875
VI M4A3E8 Thunderbolt VII — 1 725
VI AC 4 Experimental — 1 775
VI Cromwell B — 1 725
VI TOG II* — 1 750
VI Type 64 — 1 750
VI Heavy Tank No. VI — 1 875
VI Škoda T 40 — 1 850
VI Strv m/42-57 Alt A. 2 — 1 850
VI Pudel — 1 825
VII уровень
VII КВ-122 — 2 975
VII ИС-2 — 2 625
VII СУ-122-44 — 3 375
VII ИСУ-122С — 2 375
VII Panther/M10 — 2 875
VII VK 45.03 — 3 850
VII E 25 — 3 350
VII Krupp-Steyr Waffenträger -2 975
VII T23E3 — 3 500
VII T28 Concept — 3 500
VII M56 Scorpion — 2 575
VII AMX 13 57 GF — 2 500
VII FV201 (A45) — 2 475
VII AT 15A — 3 250
VII Type 62 — 2 400
VIII уровень
VIII Т-54 первый образец — 4 375
VIII СТГ — 4 850
VIII СТГ Гвардеец — 4 850
VIII ИС-6 — 5 900
VIII КВ-5 — 3 750
VIII Объект 252У Защитник — 5 475
VIII Объект 252У — 5 475
VIII ИС-3 с МЗ — 6 095
VIII ИС-5 (Объект 730) — 6 000
VIII leKpz M 41 90 mm GF — 3 250
VIII Panzer 58 Mutz — 4 350
VIII Panther mit 8,8 cm L/71 — 3 650
VIII Löwe — 6 250
VIII Rheinmetall Skorpion G — 5 450
VIII 8,8 cm Pak 43 Jagdtiger — 5 000
VIII T92 — 3 250
VIII T25 Pilot Number 1 — 3 725
VIII T26E4 SuperPershing — 3 600
VIII M46 Patton KR — 4 350
VIII T95E2 — 3 750
VIII M6A2E1 — 3 750
VIII T34 — 6 000
VIII T34 B — 6 000
VIII T26E5 — 4 850
VIII Chrysler K GF — 4 600
VIII Lorraine 40 t — 5 350
VIII AMX Chasseur de chars — 3 725
VIII M4A1 Revalorisé — 3 600
VIII AMX M4 mle. 49 — 5 850
VIII FCM 50 t — 5 950
VIII AMX Canon d»assaut 105 — 5 350
VIII FV4202 — 3 650
VIII Type 59 — 3 750
VIII 59-Patton — 3 600
VIII T-34-3 — 5 500
VIII WZ-111 — 6 125
VIII 112 — 5 250
VIII WZ-120-1G FT — 5 100
VIII STA-2 — 3 700
VIII Primo Victoria — 4 875
VIII Strv S1 — 5 450

Какие танки НЕЛЬЗЯ СДАТЬ

VII уровень
VII Т-44-122
VIII уровень
VIII Т-44-100 (Р)
VIII КВ-4 Креславского
VIII ИСУ-130
VIII Chieftain/T95

Как обменять танки по Trade-in World of tanks 2018 гайд?
Узнать о том, какой из желаемых премиум танков вы можете купить по trade-in WoT 2018, можно сразу в трёх местах в игре:


В зависимости от количества золота на аккаунте доступный для обмена танк может отображаться двумя способами:
Танк можно обменять. Золота достаточно

Танк можно обменять. Золота недостаточно

После того как вы определились, кликните правой кнопкой мыши на танк и выберите пункт Купить или Обменять.

1. По умолчанию список сдаваемых машин отсортирован по размеру «скидки» от наибольшей к наименьшей.
2. В списке также есть танки, недоступные в данный момент для обмена (в бою, не отремонтированные, в формировании). При щелчке на них в Центре уведомлений появится соответствующее сообщение.

После выбора танка на обмен возможны два варианта отображения: если покупаемая машина без скидки (рис. 1) и на скидке (рис. 2).

На экране обмена можно выполнить привычные действия: купить слот, приобрести базовый боекомплект, обучить экипаж. Но слот, если не хотите, можно не приобретать — он остаётся от сданного на обмен танка. Отличная экономия! Кроме того, даже несъёмное оборудование на сдаваемом танке снимается бесплатно.

Введите в нижнем поле нужную сумму в золоте, нажмите Обменять, и система снова показывает дополнительное окно, в котором ещё раз рассказывает, что произойдёт: сдаваемый танк будет списан, экипаж отправится в Казарму, оборудование и снаряды — на Склад.


Подтвердите своё согласие, золото спишется с аккаунта — и новый танк у вас в Ангаре.

Что нужно знать и помнить Trade-in World of Tanks 2018

Пожалуйста, внимательно прочитайте этот список, чтобы свести к минимуму возможные недопонимания системы trade-in:

1. Акция действует для премиум танков с VI по VIII уровни с 6 февраля с выхода обновления 9.22 по 20 февраля 9:00 (МСК).
2. Сдать можно только танки такого же или более низкого уровня, чем покупаемый (но не ниже VI).
3. Обмен проходит по принципу «1 к 1».
4. На цены действуют скидки: если на сданный танк есть скидка, экономия выйдет меньше!
5. Снаряды, снаряжение и оборудование на сданном танке бесплатно выгружаются на Склад.
6. Арендный стиль привязывается к определённому танку, поэтому если вы обмениваете этот танк, то стиль остаётся на Складе. Вы сможете использовать его в дальнейшем лишь в том случае, если приобретёте этот танк повторно.
7. Экипаж сдаваемого танка высаживается в Казарму. Если там нет свободных коек, обмена не будет!
8. Восстановить сданный танк за кредиты нельзя.
9. Новый слот под покупаемый танк можно не приобретать.
10. Обмен происходит только при повторном подтверждении операции (там, где рассказывается, что будет происходить с танком) — до этого обмен можно абсолютно спокойно прервать, и ничего не произойдёт.

Информация по обмену и соответствию желаемой техники в системе trade-in игроки смогут получить в игровом клиенте сразу в 3-х местах:

Согласно количеству голды на аккаунтах доступность для обмена будет выглядеть следующим образом:

В зависимости от Вашего решения выберите один из пунктов «Купить» или «Обменять», кликнув правой кнопкой по танку.

  • Изначально список сдаваемой техники будет расположен согласно значению скидок от большего к меньшему.
  • В списке игроку могут встретиться танки, которые нельзя будет в данный момент обменять (к примеру: техника находится в бою, не отремонтирована либо уже состоит в формировании).

После того как техника выбрана на обмен возможны два варианта: если покупаемая машина без скидки (рис. 1) и на скидке (рис. 2).

Стоит отметить что кроме самого обмена игрок сможет докупить слоты, пополнить боекомплект либо переобучить экипаж. Но важно помнить что слот будет уже доступен от сдаваемой по обмену техники. Плюсом так же можно считать бесплатное снятие всего оборудования.
Введите в нижнем поле нужную сумму в золоте, нажмите Обменять, и система снова показывает дополнительное окно, в котором ещё раз рассказывает, что произойдёт: сдаваемый танк будет списан, экипаж отправится в Казарму, оборудование и снаряды — на Склад.


После введения необходимой суммы и нажатия на кнопку «Обменять» вылезет дополнительное окно с информацией и действиями с экипажем,оборудование и боекомплектом для окончательного подтверждения обмена.

На что стоит обратить внимание

  • Акция актуальна для премиум техники с VI по VIII уровни в промежуток начиная с 1 июня 9:00 (МСК) по 19 июня 9:00 (МСК).
  • Обмену подлежит техника того же уровня либо ниже покупаемой, вплоть до VI лвла.
  • Обмену подлежит 1-на сдаваемая единица техники к 1-й покупаемой.
  • Стоит брать во внимание акции, уменьшающие цену той или иной техники.
  • Все расходники, оборудование и боекомплект будут выгружены на Склад.
  • Камуфляж, эмблемы и надписи привязываются к определённому танку, поэтому если вы продаёте (или в данном случае обмениваете) этот танк, то они остаются на Складе. Вы сможете использовать их в дальнейшем лишь в том случае, если приобретёте этот танк повторно.
  • Экипаж сдаваемого танка высаживается в Казарму. Если места в казарме не хватает-обмен не будет совершен.
  • Отданная по акции техника не будет возвращена за серебро.
  • За премиум техникой сохраняется слот от отданной в обмен единицы.
  • Для окончательного обмена необходимо пройти все стадии проверки и подтверждения.

Пользователи компьютерной игры World of Tanks получили долгожданную возможность обменивать танки через систему Trade-In. Теперь любой игрок имеет шанс получить другой танк, если купленный ранее ему не понравился. Конечно же, система имеет свои минусы и плюсы, а также ряд обязательных для соблюдения критериев. Если вы давно хотели сдать обратно нелюбимый вами танк, то сейчас настало то самое время. Обратите внимание, что обменивать свой танк можно только на танки уровнем ниже либо равному вашему. Вы не можете получить танк большего уровня, чем сдаете на обмен. Также для обмена подходят только танки от шестого уровня и выше, вплоть до десятого. Узнайте больше о способах обмена танков в игре ВОТ, а также условиях данной функции.

Какие танки можно обменять в World of Tanks

Как уже говорилось выше, подходит любой премиум танк, который равен шестому уровню или выше. Кроме этого, вы можете просто получить игровую валюту – голд вместо обмена танков.

  • На цену танка влияет и то, по какой стоимости вы его приобретали. Если в тот момент на него была скидка, это тоже зачтется.
  • Не забывайте, что обменивать свой танк на уровень выше нельзя.
  • Обменять можно только один танк на один новый. Вы не можете обменять один свой танк на два попроще.
  • Всё снаряжение, которое установлено на танке, его экипаж автоматически выгружаются и складываются в вашем ангаре внутри игры.
  • К сожалению, разного рода эмблемы, наклейки, надписи и камуфляж танка вы отдаете вместе с ним. Все эти элементы привязываются непосредственно к танку, поэтому пользоваться ими вы уже не сможете. Однако, если вы купите данную модель снова, вам станут доступны все эти детали снова.
  • Обмен происходит по вашему двойному согласию. Если вы подтвердили операцию один раз, но не сделали этого второй, то обмен не состоится и ваш танк останется в ангаре.
  • Кроме этого, вам не нужно приобретать новое место в ангаре под танк. Ведь вы отдаете один, а получаете другой. Таким образом, новое место не потребуется, и вы сохраните золото.

Стоит учитывать, что вся система Trade-In не идет на руку абсолютно всем игрокам: взвесьте ваше решение и оцените, выгодно ли для вас совершать такой обмен, так как за большинство обменов вам придется доплачивать голду. Цена выйдет меньше, чем покупка нового танка, однако, если сложить сумму обоих танков: того, который вы сдаете на обмен и сумму доплаты за новый, то получается, что вы переплачиваете. Лучше делать это в том случае, когда один из премиум танков вам совсем не нужен, а другой вы и так давно собирались купить. Простыми словами, это хорошая скидка на новый танк взамен одного из вашего.

Вы можете увидеть полный список танков, доступных для обмена, с их названиями на скриншоте ниже.

Как менять танки в World of Tanks

  • В меню клиента игры ВОТ есть целых три места, где вам доступен мгновенный обмен танков. Авторизуйтесь в системе и зайдите на сервер, чтобы увидеть все эти места.


  • Сверху расположены такие вкладки, как “Исследование” и “Магазин-склад”. Именно эти два раздела вам сейчас и понадобятся.


  • Зайдите во вкладку “Исследование”. Если у вас есть премиум танки, то выберете ту ветку исследований, в которой он находится. Рядом с премиум танком будет небольшой значок, нажав на который откроется окно обмена через Trade In.


  • Войдя в обычный магазин внутри клиента, премиум танки, которые могут участвовать в обмене, будут иметь на себе надпись “Доступен для обмена”. Отсюда вы также попадете в то самое окно Trade In.


  • Во время покупки премиум танка, если у вас есть другой, подходящий для этой процедуры, вы также увидите уведомление в виде небольшой кнопки на экране.


  • Обратите внимание, что осуществление сделок возможно только при наличии необходимого количества золота в вашем аккаунте World of Tanks, а также доступных для обмена танков. Если у вас нет таких танков, то, вероятнее всего, вы даже не увидите кнопок для совершения обмена.
  • Как только вы пополните свой кошелек золотом, опция откроется для вас.
  • Ниже приведена примерная таблица с суммой доплаты за премиум танки, если вы всё-таки решили их получить путем обмена в Trade In через World of Tanks.


Выбирают суровые танковые баталии. Опытные игроки помимо стандартного варианта техники, обладают премиум моделью. Зачастую она начинает надоедать и становится неиспользуемым грузом, за который были уплачены реальные деньги. Поэтому игроков интересует вопрос, как обменять танк в world of tanks.

Для этого разработчики игры предлагают танковую систему trade-in, предполагающую сдачу ставшего неинтересным или совершенно неиспользуемого танка в зачет более продвинутого варианта. Разберемся, как менять танки в world of tanks игрокам с максимальной выгодой и минимальными затратами.

Следует отметить, что обмен разрешен для премиум-танков VI-VIII уровней. При этом для покупки более продвинутого варианта техники необходимо сдать имеющуюся модель аналогичного или низшего уровня. Это означает, что приобрести по системе зачета танк VII уровня при сдаче танка VIII уровня не получится.

Важным нюансом также является самостоятельное определение разработчиками моделей, которые подлежат использованию в системе trade-in. Ознакомиться с их перечнем игроки могут в специальном приложении.

Необходимо также знать, как обменивать танки в world of tanks с учетом их стоимости. Сдаваемая техника принимается по половинной цене от существующей в игре с округлением в пользу игрока. Исходя из этого рассчитывается индивидуальная скидка при покупке нового танка со сдачей старого.

Иногда разработчики проводят акции, влияющие на стоимость обменной операции. За этим следует следить самому игроку, хотя программа максимально доступно подсказывает, какую модель участник баталий сможет приобрести, если сдаст свой танк, и какую сумму золота ему необходимо будет внести.

Как обменивать танки в world of tanks

Изучая проблему, как поменять танк в world of tanks, игроки должны осознавать, что система ранжирует модели по размеру предоставляемой скидки. Отображение осуществляется от максимального бонуса. При этом некоторые танки могут быть недоступны для обмена по различным игровым основаниям, поскольку находятся:

  • в бою;
  • в неотремонтированном состоянии;
  • на формировании.

Следует помнить, что новый слот для танка можно не покупать, а оставить его с меняемой техники. Это является дополнительной экономией системы trade-in. При этом со сдаваемого танка можно совершенно бесплатно снять даже не снимаемое оборудование.

Обмен танка в рамках trade-in осуществляется по принципу 1х1, что не позволяет взамен более дорогой модели приобрести сразу пару единиц техники подешевле. При сдаче танка в рамках данной программы все оборудование и вооружение автоматически выгружается на склад, а экипаж – в казарму.

Восстановить сданный танк назад в том же виде игроку уже не получится, поэтому программа требует нескольких подтверждений планирующегося обмена. На любом этапе обладатель боевой единицы может без проблем отказаться от операции без финансовых и прочих санкций.

Как нарисовать подбитый танк. Как нарисовать танк поэтапно для детей карандашом

Как рисовать разные модели танков.

И маленький, и взрослый художник рано или поздно решится нарисовать тяжелую технику. Результат будет зависеть от того, получится ли выделить главные детали и проигнорировать ненужные мелочи.

В статье даны подробные инструкции, как рисовать самые популярные танки простым карандашом.

Как нарисовать танк Е100 карандашом поэтапно для начинающих и детей?

В этом разделе представлена полная схема рисования таких элементов тяжелой боевой техники, как гусеницы, башни, прочие детали. Выяснив, как рисовать отдельные элементы, вы сможете легко перенести на бумагу изображение любого танка.

Танк Е100

Рисуем танк Е100 простым карандашом:

Танк Е100 массивный и крепкий. Изобразить его на листе бумаги будет несложно, если следовать приведенному ниже описанию:

  • Поворачиваем лист горизонтально. В нижней части листа изображаем параллелограмм — корпус танка, сверху на корпусе нарисуем трапециевидную башню.
  • Переходим к верхней части башни: рисуем люк, обручи пушки. Изобразим широкое циллиндрическое основание пушки и саму пушку.
  • Снизу прямо под основанием прорисовываем по всей длине вытянутый горизонтально овал. Это будут гусеницы танка Е100.
  • Рисуем четыре колеса внутри вытянутого овала — первый ряд колес гусеницы. Второй ряд из четырех колес будто перекрыт первым.
  • Остается только прорисовать мелкие детали танка. Рисуем обручи и штыри колес. Если присмотреться к схеме, то можно усовершенствовать картинку танка.


Как нарисовать танк Е100


Правильно изобразить танк Е100 на бумаге поможет и видеоинструкция.

Видео: Как нарисовать танк Е100?

Как нарисовать танк Тигр карандашом поэтапно?

Рисуем танк Тигр простым карандашом:

  • Начнем с разметки листа. Проведем ограничительные линии, внутри которых будем рисовать танк. После этого в нижней половине листа нарисуем параллелепипед.


Рисуем корпус танка — параллелепипед
  • Сверху «достраиваем» башню танка, напоминающий по форме тот же параллелепипед, вытянутый горизонтально.


Рисуем башню танка. Проводим прямую — дуло пушки
  • Изобразим бронированную юбку гусеницы: для этого нужно отступить немного от верхнего края корпуса и прорисовать фигуру, напоминающую по форме два спаренных сильно вытянутых горизонтально прямоугольника.


  • Изобразим нижнюю часть танка: контуры гусениц, дополнительные линии на корпусе танка.


  • Нарисуем прямоугольник, установив его над корпусом. Это будет башня танка. Дополнительными линиями покажем объем башни и нарисуем выступающую верхнюю часть люка.


  • Изобразим короткими линиями в передней части, и штрихами среднюю часть гусеничной ленты.


  • Поработаем над гусеницей танка: нарисуем четыре расположенных на одинаковом расстоянии больших круга, и по одному полукругу — в выступающих кверху частях гусениц. За первым рядом колес нарисуем выступающие части второго ряда.


  • К передней стенке башни добавим срезанный с одной стороны овал, продолжением которого является длинное дуло.


  • На этом этапе можно добавить недостающие детали: маленький прямоугольник на корпусе — запасной люк и фигуру, напоминающую полукруг, из которой потом нарисуем маленькую пушку.


  • Теперь можно дорисовать гусеницу, недостающие полукруглые линии на колесах.


Нарисованный эскиз танка можно разукрасить темно-зеленым, коричневым цветами.



Попробуем изобразить немецкий танк Тигр иначе. Упростит нам задачу то, что танк этот прямоугольной формы. Однако для реалистичной картинки необходимо нарисовать множество мелких деталей, которые имеют непростую форму. Но мы же стремимся красиво изобразить тяжелую технику!

  • Намечаем на листе прямыми линиями (без нажима на карандаш) место, где будет расположен танк. Начинаем с верхушки танка. Рисуем командирский люк. Для этого рисуем небольшой овал, потом — петли и крышку.


Располагаем сверху на листе командирский люк
  • Детализируем основание люка. Дорисовываем рядом с ним колпак вентилятора: небольшой овал — верхняя часть, маленькие прямоугольники — линзы.


Детализируем люк
  • Теперь можно изобразить и саму крышу башни: округлая задняя часть постепенно переходит в трапецию.


Рисуем крышу башни
  • На крышке башни находится еще один люк и перископ заряжающего. Изобразим их с помощью простых геометрических фигур, придавая им нужную форму. Проведем через трапецию линию, которая покажет скос передней части крыши башни.


Добавляем еще один люк и перископ на башне
  • Рисуем видимую часть борта башни двумя изогнутыми линиями. И готовимся к более сложной задаче.


Прорисовываем видимую часть борта башни
  • Итак, приступим к изображению маски 88 миллиметрового орудия. Нарисуем большой прямоугольник, в центр которого впишем еще два, закругляя края. Соединительными линиями придаем нужную форму маске орудия. В центральной части маски будем рисовать пушку, а пока изобразим слева небольшой вытянутый вертикально прямоугольник. Здесь мы позже нарисуем амбразуру спаренного с пушкой пулемета.


Рисуем маску оружия
  • Рисуем основание пушки: это два цилиндра разной толщины, которые входят друг в друга. Цилиндр с широкими стенками находится у основания башни, а с тонкими — является продолжением широкого.


Рисуем основание пушки
  • Рисуем оставшуюся часть пушки — более тонкий цилиндр. Рисуем дульный тормоз: две цилиндрические фигуры, которые соединяются выступающим кругом.


Дорисовываем пушку
  • Добавляем недостающие элементы башни: жирная точка на маске орудия — амбразура спаренного пулемета. Дорисовываем маску с правой стороны, показав там амбразуру монокулярного прицела. Покажем несколькими линиями прибор наблюдения и рым. Нарисуем ящик для снаряжения: три трапеции, расположенные полукругом по форме башни.


Добавляем некоторые детали на башне
  • Изобразим крышу корпуса танка в виде прямоугольника.


Рисуем крышу корпуса
  • Прямыми линиями покажем бортовые броне листы. Снизу под пушкой нарисуем смотровое устройство механика водителя. Чтобы эта часть танка получилась, рисуем простые фигуры, придавая им нужную форму.


Прорисовываем бортовые бронелисты
  • Надгусеничным полкам придаем форму прямоугольников. Добавляем недостающие линии, сверяясь с картинкой.


Рисуем надгусеничные полки
  • Рисуем моторный отсек и перископ, также придавая им простые геометрические формы.


Рисуем моторный отсек и перископ
  • Небольшими овалами под пушкой изобразим люки механика водителя и радиста под пушкой.


Рисуем люк механика водителя
  • Дорисовываем мелкие детали: пулемет, фары, тросы.


Добавляем мелкие детали
  • Переходим к ходовой танка. Изобразим гусеницы. Дорисуем нижнюю лобовую деталь, элементы ведущего и направляющего колес.


Рисуем мелкие детали

Рисуем гусеницу
  • Изобразим на гусенице частично опорные катки.


  • Дорисуем четыре опорных катка. Остальные две пары опорных катков находятся вне зоны видимости из-за шахматного расположения.


  • Изобразим последние элементы танка: тросы, крюки на крыше корпуса, покажем изогнутыми линиями рельефность опорных катков.




  • Теперь можно разукрасить танк и добавить элементы ландшафта: дорогу, гору или еще один танк вдалеке.


Танк можно нарисовать в другом ракурсе. Например, вот так:

Как нарисовать танк Тигр
  • Обрисовываем первоначальные контуры танка. Здесь нужно учесть наклон корпуса и башни, а также правильно изобразить пушку. если у вас не получается рисовать прямые линии, то вооружитесь линейкой.


  • Поработаем над точным изображением башни танка, дорисовав некоторые детали.


  • Детализируем пушку и переходим к верхней части корпуса танка.


  • Рисуем бронированную юбку танка.


  • Переходим к прорисовке нижней части танка: гусеницы, оптического прибора.


  • Рисуем видимую часть гусеницы.


Рисуем трек танка: колеса, расположенные в шахматном порядке.



Видео: Как нарисовать танк тигр?

Попробуем изобразить еще один вражеский сверхтяжелый танк Маус.

Вот что мы будем рисовать:



Как нарисовать танк Маус
  • Рисуем верхушку башни и от нее проводим дополнительные линии, чтобы показать объем. Намечаем несколькими линиями рым. На правой стороне башни, которую мы изобразили под небольшим наклоном, нарисуем маленькое отверстие.


Рисуем верхнюю часть танка — башню
  • Рисуем широкие основания для пушки и пулемета. Сразу рисуем короткое дуло пулемета.


Рисуем основание пушки
  • Добавляем недостающие детали на основании пушки и прорисовываем длинное дуло. С основным вооружением танка мы справились!


Рисуем длинное дуло пушки
  • Башню танка «устанавливаем» на корпус танка, изобразив его в виде прямоугольника под небольшим наклоном. Лобовой бронелист танка также рисуем под наклоном.


  • Изобразим в виде вытянутого горизонтально овала видимую часть гусеницы и добавим массивные экраны на них. Нарисуем буксировочные кольца.


  • Изобразим фары и швы на броне танка. Добавим несколько линий на экраны.
  • Корпус танка пересекает горизонтальная линия. Изобразим ее, отступив немного от срединной линии.


  • Дорисуем контуры экрана гусеницы.


  • Детализируем корпус танка, добавляя недостающие элементы.


  • Несколькими линиями намечаем систему охлаждения. Снова добавляем линии на корпусе.
  • Добавляем три люка сверху на башне.


  • Добавляем швы на башне и на корпусе танка.




Видео: Как нарисовать танк Маус?

Видео: Как нарисовать Maus?

Как легко и красиво нарисовать танк ИС-7 карандашом?

Рисуем танк ИС-7:



Танк ИС-7
  • Немного отступив от срединной линии листа, проведем отрезок, который станет общей стороной двух прямоугольников.
  • Изобразим эти два прямоугольника. Проведем линии, пересекающие нарисованные прямоугольники немного выше срединной линии. Это будет контур гусениц. Прорисуем их более детально.
  • Над корпусом танка «надстраиваем» башню. Придаем ей форму трапеции. Изогнутыми линиями показываем контур башни и рисуем дуло пушки. Добавляем несколько линий на гусеницах и помечаем крестиками места, где будут колеса.
  • Прорисовываем первый ряд из четырех колес, а за ними располагаем второй ряд. Дорисовываем необходимые элементы на башне, на пушке и на корпусе.

Видео: Как нарисовать ИС-7

Рисунки танка карандашом детям для срисовывания на 23 февраля и 9 мая День Победы

Ребенку сложно нарисовать танк без помощи взрослого. Пригодятся для этого простые изображения танков без прорисовки мелких деталей. Поищите подходящий рисунок, для выполнения которого не требуется особых художественных навыков, и вы сможете провести с ребенком увлекательное занятие по изучению и рисованию тяжелой военной техники.

Чтобы правильно изобразить танк, обратите внимание на следующее:

  • Изображая технику нужно следить за кривизной линий и их направлением.
  • Все линии наносятся без нажима на карандаш, тогда допущенные ошибочные штрихи можно легко удалить, не оставив следов на бумаге.
  • Любые неправильные линии следует удалять сразу же, чтобы они не отразились на конечном результате.
  • Начиная рисовать сложный объект, необходимо придать ему простую геометрическую форму, и только потом начинать прорисовывать детали.

Чтобы танк не казался плоским, нужно придавать деталям объем с помощью штриховки или дополнительных линий.

Представленные ниже схемы рисования танков помогут нарисовать красивую открытку или украсят праздничную стенгазету, посвященную 23 февраля или 9 мая.






  • Чтобы нарисовать фантазийный танк, также необходимо учитывать, что это сложное транспортное средство, потому прорисовки мелких дополнительных деталей не избежать. Ведь изображение даже мультяшного танка должно быть узнаваемым.
  • Рисунок фантазийного персонажа, напоминающего танк, украсит поздравительную открытку, коллаж или стенгазету, подготовленную к празднику 23 февраля, 9 мая. Картинку с веселым танком можно подарить и любителю компьютерной игры «Танки Онлайн».

Танк можно изобразить «одушевленным»: сделать его дружелюбным персонажем или придать серьезный вид.



Инструкция

Затем на верху получившейся фигуры необходимо нарисовать еще одну длинную трапецию, меньшую по размеру.

На ней следует изобразить третью фигуру, снова трапецию, только уже маленькую.

Теперь нижнюю, самую длинную, фигуру необходимо заполнить несколькими окружностями. Две крайние из них должны получиться чуть меньше остальных.

Теперь пришло время прорисовать гусеницу танка. В ее состав входят круглые колеса и цепь, объединяющая их в одну фигуру.

Детали, являющейся нижней стороной средней части корпуса танка, следует придать толщину.

Верхнюю и среднюю трапеции нужно соединить двумя прямыми короткими линиями.

На располагающейся посередине трапеции (корпусе танка) нужно нарисовать пару маленьких прямоугольных деталей (крышек). Они закрывают доступ к сложным механизмам танка. Спереди следует добавить маленький округлый , а на ящике, находящемся в правой части танка, нужно нарисовать ремни. Рисунок готов.

Обратите внимание

Сейчас вы узнаете, как нарисовать танк. Шаг 1. Рисовать танк начнем с гусеницы. Нарисуйте квадрат, а по бокам треугольники с закругленными сторонами. Шаг 2. Теперь сгладим наши углы. Шаг 3. Внутри нарисуйте аналогичные линии. Они должны быть параллельны. Шаг 4. Рисуем колеса. Нарисуйте два круга, слева и справа, и маленькие круги внутри них.

Полезный совет

Как нарисовать танк карандашом. ШАГ 1. Итак начинаем с обрисовки формы танка, для этого можете воспользоваться помощью линейки. Нарисуем люк, который помогает солдатам выходить из танка. (В прошлом уроке мы рисовали уже солдата, вертолет и АК-47, для любителей рисовать военную технику рекомендую!) ШАГ 3. Дальше делаем чертеж снаряда, которым стреляет танк.

Источники:

  • рисовать танки

Нарисовать танк не так просто, как кажется не первый взгляд. В первую очередь это связано со его структурой — махина представляет собой корпус с прикрепленной сверху башней, вращающейся на 360˚, гусеницами и дулом. Но поняв, как рисуются эти основные элементы, вы сможете справиться с задачей.

Вам понадобится

  • — бумага;
  • — карандаш;
  • — ластик.

Инструкция

Сделайте наброски танка, дуло которого направлено в сторону. Изобразите горизонтальную линию, чуть изогнутую посередине. Проведите под ней еще две прямые линии, пересекающиеся в месте, расположенном под точкой изгиба верхней. Соедините эти места вертикалью. Также проведите вертикалями внешние граничные точки двух линий. Затем дорисуйте призму, расположенную на основной части корпуса танка, которая будет символизировать башню танка.

Наметьте границы . Две линии нижней части корпуса изобразите небольшими дугами. С внутренней стороны добавьте еще две черты, изображающие ширину гусениц. Проведите горизонталь – поделите гусеницы пополам. Под ней нарисуйте колеса, располагающиеся в середине гусениц. Для этого линию колес поделите на равные отрезки, каждый из которых будет являться осевой линией одного колеса. Размеры колес должны быть неодинаковыми – те, что размещены ближе к передней части, нарисуйте более крупнее, нежели колеса, находящиеся в задней части танка.

Нарисуйте дуло танка. В верхней части проведите прямую линию, а под ней наметьте еще одну. Ближе к основанию дула прорисуйте несколько колец, размещенных на некотором расстоянии друг от друга.

Сделайте прорисовку деталей. От основания дула вниз до серединной линии гусениц проведите две параллельные линии. Прорисуйте щитки, закрывающие гусеницы. Один из них проведите по всей длине танка, а второй изобразите небольшой видимой его частью, которая выглядывает из-за корпуса танка. Мелкие детали стоит рисовать жестким типом для более четкой прорисовки.

Затемните внутреннее пространство около колес. Проведите горизонтальные линии по всей ширине гусениц для изображения их рельефности. Обратите внимание, что размеры гусениц должны быть примерно в 2 раза меньше высоты всего танка.

Пушка – это вид артиллерийского оружия. В прошлых веках это оружие применялось довольно таки часто. Ее устанавливали также на корабли, где она была просто незаменима. А как же такое орудие?

Вам понадобится

  • — альбомный лист;
  • — карандаш;
  • — ластик.

Инструкция

Сделайте общие наброски пушки. Сначала посередине листа нарисуйте длинный узкий овал, расположенный по диагонали, левым краем вверх. Это будет дуло орудия. Под ним на некотором расстоянии проведите прямую линию, параллельную овалу.

Соедините линию с дулом плавными линиями, расположенными с обоих концов прямой. Таким образом изобразите лафет – подставку под оружие. Прикрепите видимые колеса – начертите окружности так, чтобы нижняя граница лафета перерезала бы их почти пополам.

Прорисуйте детали дула пушки. Верхний конец чуть сузьте, а нижний немного расширьте. В широкой части изобразите торец – нарисуйте круг, половина которого является крайней границей овала. Теперь прикрепите ручку орудия.

Изобразите кольца, которые размещены в нескольких местах дула оружия. Проведите изогнутые линии, выпуклостями обращенными к верхнему концу дула и с выступающими за пределы овала границами. Нарисуйте место для фитиля. Обозначьте его небольшой окружностью, размещенной на верхней площадке дула.

Прорисуйте детали лафета. Верхнюю и боковую границу видимой стенки изобразите двойной линией, символизируя толщину доски. В верхней части нарисуйте два болта – небольшие овалы, разделенные кривыми линиями для объемности. Дорисуйте продолжение крепления.

Изобразите дно лафета: к крайней части боковой стенки дорисуйте линию, расположенную почти под прямым углом к ней. Опять же изобразите толщину доски, проведя вторую прямую, параллельную первой. Пройдитесь по всем видимым частям лафета короткими штрихами для придания вида структуры дерева.

Нарисуйте детально колеса. Начертите овалы, расположенные диагонально в одном направлении с наклоном пушки. Разделите их выпуклыми линиями, отделяя видимую боковую часть от верхней, которая является показателем толщины колеса. Посередине колес нарисуйте крепления.

Дорисуйте детали пушки. Изобразите подпорки под колеса, изобразив их сначала кубом. Также нарисуйте ядра пушки – небольшие круги, диаметр которых не должен превышать величину самой тонкой части дула.

Видео по теме

Обратите внимание

Самый простенький танк можно нарисовать, как показано на рисунке. Для этого сначала нужно нарисовать корпус танка, потом гуслю, потом все чтоб было похожи, что это катки. Конечно, нарисовать пушку. Когда будет все нарисовано самое главное, то можно уже приступать разукрашивать танк.

Полезный совет

Нарисуем больше деталей для башни танка. Сейчас нам надо разбить башню танка на две части. Для этого нарисуем круглую линию около пушки. Дальше сделаем пушку танка немного тоньше, и добавим к ее началу несколько обручей. Как нарисовать самолет Рисовать самолет не так уж и сложно. Для того чтобы нарисовать самолет, нужно лишь знать некоторые особенности его строения.

Многие мальчишки с раннего детства любят рисовать картинки на военную тематику – солдат, самолеты, вертолеты, пушки, бронетранспортеры. Самый популярный рисунок у детей – танк, но эта машина считается сложной в изображении, поэтому рисовать ее лучше поэтапно и с помощью взрослого.

Как нарисовать карандашом танк поэтапно

Эта картинка рисуется совсем просто, нужно только следовать инструкции:

  • посередине листа проведите горизонтальный отрезок, равный по длине размеру вашего танка. Постройте равнобедренную трапецию, взяв за основание первую линию;
  • опустите вниз от получившегося четырехугольника два наклонных вовнутрь луча. Соедините их, как на схеме и получите нижнюю часть корпуса;


  • сверху меньшей фигуры пристройте прямоугольник, сделав его правую сторону выпуклой. Наметьте над ним, сдвинув немного влево, равностороннюю трапецию – это вышка-башня танка;


  • с левого бока вышки изобразите неправильный четырехугольник. От него вверх и в сторону проведите две параллельные прямые – будущий ствол, на конце которого вычертите квадратный эжектор – устройство для продувки выхлопного отверстия от пороховых газов;


  • продублируйте внутренней наметкой обод танка, сделав гусеничный трек. Нарисуйте в нем три больших круга посередине и столько же маленьких – один в левом верхнем углу и два в правом нижнем. Между крупными колесами изобразите пирамидки, которые соединят гусеничную ленту воедино;


  • с помощью незначительных мелочей – зубчиков, кружочков, прямоугольников придайте гусенице правдоподобный вид. Сделайте дуло объемным, прорисовав тщательно детали, а башню, люк, корпус выделите жирными линиями, и танк будет выглядеть, как настоящий.


Как нарисовать мультяшный танк поэтапно

Маленькие дети могут нарисовать танк самостоятельно, если при создании картинки использовать только крупные детали и не задействовать мелкие. Понадобится: альбомный лист, карандаш, ластик.

  • На листе бумаги нарисуйте прямоугольник и разделите его на три квадрата. Квадрат посередине оставьте как есть, а из боковых – сделайте треугольники с округлым основанием.
  • У вышедшей фигуры, напоминающей лодочку, закруглите два верхних уголка, чтобы получился овал. Отступите от него внутрь 1 см и проведите параллельную замкнутую линию.
  • Нарисуйте в гусенице четыре небольших колеса с маленькими кружочками посередине.
  • Сверху заготовки нахлобучьте броню и купол в виде двух четырехугольников со срезанными правыми верхними уголками.
  • Изобразите с правой стороны пушку, похожую на наклоненную печную трубу.


Раскрасьте танк красками или гуашью, пририсуйте фломастером пятиконечную звезду и рисунок готов.


Как нарисовать красками танк поэтапно

Более усложненный вариант, так как идет прорисовка мелких деталей, и картинка выполняется красками.

  • Нарисуйте длинный и плоский эллипс. Сверху, с промежутками по 0,5 см, изобразите две трапеции – одну длинную, другую высокую.


  • Нижнюю фигуру заполните кружками, на средней – нарисуйте прямоугольный бак и удвойте линии гусениц.


  • Слева возведите пушку, выходящую из овального основания. Обведите гусеницы танка двойными кружками, это придаст объем всей фигуре.


  • Наметьте крышки на корпусе машины, на ящике – тросы, на башне – смотровые приборы, а спереди танка – фонарик.


Выполните танк в зеленом цвете, а звезду – выделите красным.


Теперь вы знаете, как нарисовать танк разными способами. Так что практикуйтесь на простых моделях и через некоторое время вы не только сможете изобразить танк с большим количеством деталей, но и выполнить рисунок в штриховке или акварели.

Простые советы помогут узнать, как нарисовать танк на бумаге, чтобы он выглядел очень правдоподобно, а детали смотрелись реалистично. Это отличный способ совместного времяпровождения родителей с ребенком. Особенно интересно будет обучаться рисованию танков мальчикам, которые с раннего детства интересуются военной техникой, оружием. На первый взгляд кажется, что для изображения танка необходимы навыки рисования, которые получают в художественной школе. Безусловно, владение разными техниками рисования поможет сделать рисунок на профессиональном уровне. Но при желании каждый сумеет изобразить непростую, на первый взгляд, военную машину на обычном альбомном листе с помощью простого карандаша. Можно брать другие принадлежности, например, краски, но с ними работать намного сложнее. По этой причине мы рекомендуем поэтапно учиться рисовать танк в карандашной технике, для чего потребуется мягкий карандаш, ластик, бумага.

Если вы хотите выполнить рисунок в цвете, рекомендуем научиться использовать цветные карандаши, а потом переходить на краски, поскольку техника акварельной, масляной живописи требует от исполнителя определенных навыков. Рисунок карандашами — относительно несложный. Популярными являются изображения танков, выполненные обычным карандашом. Мальчик 8 – 10 лет уже без труда справится с такой задачей . Если вы хотите обучить ребенка рисованию боевой машины, рекомендуем потренироваться.

Очень важно выполнять все описанные ниже действия поэтапно.

Схемы для рисования

Схемы, благодаря которым можно узнать, как нарисовать танк, отличаются по уровню сложности, в зависимости от модели боевой машины, техники рисования. В любом случае очень важно выполнять все действия поэтапно, чтобы облегчить задачу и получить превосходный результат.

Людям, имеющим опыт в рисовании, можно использовать более сложную схему. Красивый рисунок танка получится, если проработать все детали, придать светотень, выделить некоторые детали темным цветом. Для этого важно работать мягким простым карандашом, который идеально подходит для рисования.

Понятной является схема вот такого советского танка. В ней также важно осуществлять все действия поэтапно. Важно отметить, что к процессу стоит отнестись творчески. Чтобы понять, как должен выглядеть танк, рекомендуем ознакомиться с многочисленными фотографиями реальной боевой техники, изучить его строение и принцип работы. Если у вас есть художественные способности и навыки рисования, можно попробовать срисовать военную технику непосредственно с реальной фотографии либо модели.

Рисунок танка можно осуществить с помощью разных техник. В процессе подготовки следует определить, какую модель боевой машины вы хотите изобразить. Желательно начать обучение с рисования черно-белой картинки, которая выполняется обычным карандашом. Мы не рекомендуем рисовать танки детям, не достигшим младшего школьного возраста, поскольку для них этот процесс может показаться сложным. В процессе рисования очень важно уделить внимание деталям.

Нарисовать танк карандашом несложно. Главное здесь – уметь выделять главные детали и опускать ненужные мелочи. Рассмотрим поэтапно, как легко нарисовать танк Т34. В этом вам помогут картинки видео на нашем сайте.

Т34

1. Сначала рисуем основу для танка. Ею будет выступать шестиугольник, внутри которого проводим горизонтальную линию. Она поможет изобразить гусеницы одного и того же размера. Из гусениц проводим пару трапеции сбоку и спереди. Это будет основа танка.

Этап 1: рисуем основу танка

2. Башня танка изображается с помощью прямоугольника с округлыми краями. Из башни проводим пушку, а линии соединят башню с корпусом.

Этап 2: рисуем башню и корпус танка

Этап 3: рисуем гусеницы

4. Добавляем детали в виде бензобака, люка, ступенек.

Этап 4: добавляем детали танка

5. Башню танка делим на пару частей округлой линией. Затем рисуем обручи вокруг пушки и люк.

Этап 5: дорисовываем башню

6. Добавляем детали. Рисуем протектор на гусеницах. Затем начинаем прорисовку внутреннего обода и штырей колес. Возле крайних колес прорисовываем зубчики. Заштриховываем и затеняем колеса.

Этап 6

Рисуем танк Т34:

Тигр

1. Рисуем основные контуры танка тигр с сильно выступающей пушкой.

Этап 1: намечаем контуры танка Тигр

2. Обозначаем основные части танка тигр, катки и ствол, а также более мелкие детали.

Этап 2: обозначаем основные детали танка

3. Добавляем детали навесного оборудования. Намечаем ходовую часть.

Этап 3: дорисовываем навесное оборудование и колеса

4. Заштриховываем танк, тонируем отдельные детали, придаем объем танку тигр.

Этап 4: заштриховываем танк

Видео-инструкция

Маус

Танк Маус также легко нарисовать карандашом. Вот как это можно сделать поэтапно.

1. Изображаем прямоугольник со скругленными краями. Сверху рисуем трапецию – корпус танка маус.

Этап 1: изображаем основы танка

2. Сверху корпуса прорисовываем башню танка маус: изображаем трапецию, скругленную с левой стороны. Рядом рисуем еще один полукруг, а из него – пушку.

Этап 2: рисуем башню, пушку и колеса

3. На следующем этапе изображаем люк, гусеницы и запасной бак.

Этап 3: дорисовываем люк и гусеницы

4. В конце украшаем танк маус символикой в виде креста.

Этап 4: разрисовываем танк Маус

Е100

Танк е100 несколько отличается от предыдущего. Это сверхтяжелый танк. Внешне его корпус выглядит более массивным и крепким. Чтобы нарисовать танк е100 карандашом поэтапно, следуем следующим рекомендациям:

1.Рисуем параллелограмм, а сверху – трапецию. Это корпус и башня танка е100.

2.Сверху на башне обозначаем люк, обручи пушки и саму пушку с толстым основанием.

3.Внизу под параллелограммом рисуем полукруг по всей длине – гусеницы танка е100.

4. В полукруг вписываем колеса так, чтобы одно слегка перекрывало другое.

5.Завершаем рисунок мелкими деталями танка: обручи и штыри колес.

На картинке вы увидите рисунок и схему танка е100. Нарисовать его также поможет видео у нас на сайте.

1. Изображаем два прямоугольника с одной общей стороной.

2. Там, где будет находиться туловище танка ис7, рисуем горизонтальную линию, прорисовываем контуры гусениц.

Этап 2: дорисовываем туловище танка

3. Сверху трапецией обозначаем башню танка ис7 и дуло пушки, крестиками намечаем места для колес.

Этап 3: рисуем пушку и места колес

4. Рисуем колеса гусениц и детали на башне танка ис7.

Этап 4: рисуем гусеницу и добавляем детали

5. Останется заштриховать и затонировать отдельные части танка.

Этап 5

КВ1

Легко с помощью основных геометрических фигур можно нарисовать еще одну модель танка – кв1.

1. Рисуем параллелепипед – туловище танка кв1.

Этап 1: рисуем параллелепипед — туловище танка

2. На той стороне, где будет располагаться перед, проводим по бокам две вертикальные линии и одну линию по диагонали между ними. Сверху изображаем округлую башню танка кв1.

Этап 2: обозначаем перед и круглую башню

3. Намечаем контуры пушки.

Этап 3: намечаем контуры пушки

4. Прорисовываем детали танка кв1 и гусеницы, первоначально наметив, где будет располагаться каждое колесо (они не должны заходить друг на друга).

Этап 4: прорисовываем детали и пушку Этап 5: обозначаем гусеницы

5. Заштриховываем и тонируем рисунок.

Этап 6: заштриховываем рисунок

КВ-1С

В целом, конечно, общая схема изображения танков будет совпадать. Таким образом, зная, как рисовать танки вообще, можно варьировать их модели на картинках. Нарисуем танк кв1с.

1. Изображаем те же знакомые нам прямоугольники с общей стороной.

Этап 1: рисуем два прямоугольника

2. Делим их пополам горизонтальной линией и прорисовываем контуры гусениц. Сверху обозначаем башню танка кв1с.

Этап 2: помечаем туловище и контур гусениц

3. Линией определяем внутреннюю часть гусеницы.

Этап 3: помечаем внутренню часть гусеницы

4. Обозначаем контур пушки и места для колес гусеницы.

«Маус» — самый тяжелый танк из когда-либо построенных

Во время Второй мировой войны нацистская Германия была хорошо известна своей передовой бронетехникой.

Дизайн для танков, которые становятся все больше и больше.

Panther

Был 44-тонный средний танк Panther и одна из лучших машин Второй мировой войны.

Tiger I

Затем был Tiger I, 54-тонный монстр, который был эффективен, но дорог и сложен в изготовлении.

Panzer VI «Tiger I» в Тунисе, 1942/1943

Tiger II

Затем появился Tiger II или King Tiger, крупнейший немецкий танк, принимавший участие во Второй мировой войне.68-тонный бегемот, практически неуязвимый для танков и противотанковых орудий союзников.

Jagdtiger

Но подвел неподходящий источник энергии и сложное производство, и, наконец, самая тяжелая бронемашина, которая еще не участвовала в боевых действиях, 71-тонный истребитель танков Jagdtiger.

Но немецкие конструкторы сделали еще один шаг вперед по сравнению с этими массивными машинами, чтобы создать танк таких гигантских размеров, что это казалось актом безумия, Panzerkampfwagen VIII или Maus.

Maus

Имея невероятную массу в 188 тонн, Германия успела построить только две таких машины до окончания войны. Но в чем причина такого, казалось бы, нелогичного замысла?

Маус был создан доктором Порше. И Гитлер, большой сторонник более крупных и тяжелобронированных машин, одобрил проект в июне 1942 года. Первоначально он собирался называться Mammoth, но в итоге получил безобидное имя Maus. 1 мая 1943 года Гитлеру показали деревянный макет «Мауса», он ему понравился.

Деревянная модель Maus для Адольфа Гитлера, 14 мая 1943 г.

Ширина гусениц составляла 1,1 метра, машина приводилась в движение бензиновым двигателем V12, позже замененным во втором прототипе на дизельный. Maus был 10,2 м (33,6 фута) в длину, 3,71 м (12,2 фута) в ширину и 3,63 м (11,11 фута) в высоту. Экипаж 6 человек, действовал внутри толстой брони. Лоб башни имел толщину 220 мм (8,7 дюйма). По бокам и сзади 200 мм (7,9 дюйма). Лоб корпуса имел ту же толщину, что и борта башни, а уязвимая корма — 150 мм (5,5 мм).9 дюймов).

Гитлер настаивал на том, что основным вооружением «Мауса» была 128-мм пушка KwK 44 с боезапасом 68 снарядов, а также 75-мм пушка в качестве спаренного вспомогательного вооружения.

Так какая польза от такого бегемота на поле боя? Предполагалось, что Maus будет практически несокрушимым танком прорыва, пробивающим линию противника, чтобы открыть брешь для более регулярных танковых и танковых гренадеров. Проблема заключалась в транспортировке такого танка и пересечении мостов, он был слишком тяжелым, и вместо этого ему пришлось бы преодолевать реки вброд.

Первый настоящий прототип V1 представлял собой безбашенную испытательную машину, завершенную в декабре 1943 года. Была добавлена ​​макетная башня того же веса, что и реальная конструкция.

Maus V1

Затем в июне 1944 года V1 получил тестовую башню с настоящей пушкой и приступил к огневым испытаниям. Второй прототип V2 был доставлен в марте 1944 года, он получил серийную башню и дизельный двигатель. Ни один танк не участвовал в боевых действиях, несмотря на слухи в Интернете.

Maus на полигоне

В 1945 году оба прототипа Maus находились на испытательном полигоне в Куммерсдорфе.V2 был отправлен в Вюнсдорф для защиты бункерного комплекса высшего командования армии от быстро приближающейся Красной Армии. Он был припаркован возле бункера Maybach I и был взорван до того, как его захватили Советы.

V1 также был уничтожен, но не так сильно, как V2. Советские инженеры решили собрать из двух подбитых прототипов один полный танк. Это был сложный процесс из-за огромного веса автомобиля.

Башня «Фау-2» весила 55 тонн, столько же, сколько и полный «Тигр I».Чтобы вытащить башню из разбитого корпуса, они использовали шесть трофейных немецких 18-тонных полугусениц Famo, успешно соединенных с корпусом V1, полный Maus прибыл в Советский Союз для различных испытаний в мае 1946 года.

Трофейный немецкий Panzerkampfwagen VIII «Maus» и Sturmpanzer VI «Sturmtiger» на пути в Кубинку, 1945 г.

проектировать и строить танки.

Maus в музее Кубинки

Танки в истории — Неуловимый Maus

Юрий Пашолок


Великобритания и СССР активно обменивались информацией о противнике во время Второй мировой войны. СССР даже поделился своими трофеями, например, захваченные в СССР танки Panther и Pz.Kpfw.III Ausf.L были отправлены в Великобританию. Однако после окончания войны эти отношения испортились, и обмен информацией прекратился. Поскольку оба опытных прототипа Maus оказались в руках Красной Армии, британцам пришлось собирать обрывки информации об этом танке по всей зоне оккупации.Насколько хорошо действовали британские следователи и насколько правдивой была собранная ими информация?


Последний писк

Maus впервые упоминается в Сводке технической разведки DRAC (Директор Королевского бронетанкового корпуса) за май 1945 года. Описание довольно краткое:

«Разработки в области проектирования немецких танков, по-видимому, в основном ограничивались сверхтяжелым классом. Три оборудования, подпадающие под эту рубрику, были проверены следующим образом: Maus (Мышь).Это танк расчетной массой 200 тонн с 12,8-см Kw.K.82 (L/55) и спаренным 7,5-см Kw.K.44 (L/36,5) в башне с поворотом на 360°. ”

В сводке также упоминались танк Е-100 и САУ Grille, но информации по этим машинам также было мало.

Офицеры 1-й Польской бронетанковой дивизии и три комплекта деталей брони Maus, полигон Круппа в Меппене.

Вскоре появилась дополнительная информация.Три корпуса и башни Maus были найдены на полигоне Krupp в Меппене. Они были пустыми, но с ними предположительно была связана установка со 128-мм и 75-мм пушкой. В документах, найденных на полигоне, указано, что орудие раньше называлось 12,8 cm KwK 44 (Maus), а позже было переименовано в 12,8 cm KwK 82. В документах также указывалось, что этот танк выпускался не в больших количествах и не более шести комплектов. были построены корпуса и башни. Три комплекта на полигоне были доставлены туда для испытаний на проникновение.Орудия Maus также были экспериментальными и прибыли в Меппен для испытаний в ноябре 1943 года. Этикетка на ящике с боеприпасами датирована 3 января 1944 года.

В отчете указывалось, что конструкция корпусов и башен отличалась от последних немецких разработок. Пластины сцеплялись друг с другом, а количество угловых поверхностей было минимальным. Танк фактически имел разнесенную броню вдоль бортов, так как броня юбки спускалась за пол боевого отделения.

Двигатель находился не сзади, как обычно, а посередине, между боевым и водительским отделениями.Трансмиссия находилась сзади. Элементов трансмиссии в корпусе не было, но автор доклада предполагал, что трансмиссия будет электрической, как на истребителе танков «Элефант».

Британские размеры брони Maus. Некоторые измерения являются приблизительными.

Британцы не успели взвесить и измерить детали до написания отчета. Расчетная масса башни составляла 34 тонны, а весь танк весил около 200 тонн.Размеры башни, корпуса и гусениц также были приблизительными.

Англичане торопились получить информацию о танке и не проверяли тщательно свои источники, допрашивая всех, до кого могли дотянуться. Например, основным источником первоначальных сообщений был инженер, работавший на полигоне. Была только одна проблема: у него не было опыта обращения с «Маусом» и вообще не было опыта обращения с танками. Он специализировался на бетоне, а его работа заключалась в том, чтобы построить курс подводного тест-драйва для танка.Все, что он знал о «Маусе», основывалось на слухах, так что не стоит удивляться, что его информация не совсем верна.

По данным источника, работы над проектом начались весной или летом 1942 года при поддержке министра вооружений и военного производства Шпеера. Танк якобы назывался Mammut (Мамонт). В 1943 году этому инженеру было поручено построить курс подводного вождения, способный вместить 200-тонный танк. Это была очень интересная задача, так как масса танка Mäuschen («Мышь») к тому времени составляла всего 100 тонн.Из бесед с военпредами и другими инженерами он узнал, что новый танк будет иметь дизельный двигатель MB 517 или бензиновый DB 603, электрическую трансмиссию, параллельные торсионы, как у «Элефанта», и защиту от отравляющих газов. Экипаж насчитывал 6-7 человек.

По словам инженера, один Maus был построен и испытан в Линце, Австрия, где он оставался до конца войны. Что касается проекта в целом, то Гитлер отменил его в начале 1944 года из-за чрезмерной стоимости и нехватки меди.

Был опрошен и более надежный источник, но и он не смог дать точной информации о проекте. По словам Курта Арнольда, руководителя испытательного полигона Henschel, изначально предполагалось, что танк будет весить 150 тонн, но в процессе разработки он вырос до 200 тонн. Maus оснащался двумя двигателями мощностью 850-1000 л.с., которые так и не достигли требуемого уровня надежности. Танк можно было перемещать на большие расстояния только по железной дороге. Броня имела толщину 190-210 мм, а дополнительные листы толщиной 90 мм защищали подвеску.Вывод его рассказа совпал с рассказом инженера-бетонщика: проект закрыли в апреле 1944 года из-за технической сложности и неблагоприятной обстановки на передовой.

Не имея других источников информации, англичане продолжили осмотр имеющихся узлов и агрегатов. Специалисты отмечали, что широкие гусеницы сильно ограничивали пространство внутри танка. Несмотря на то, что пространство между верхними сторонами было шириной 3645 мм, расстояние между нижними сторонами составляло всего 1155 мм.Это ограничивало высоту боевого отделения, так как пол подбашенной корзины не мог быть ниже кофров.

Корпус состоял из четырех секций, отделенных друг от друга переборками толщиной 20 мм. Водительское отделение располагалось в передней части. Как упоминалось выше, англичане могли только догадываться о количестве находящихся здесь членов экипажа. В крыше отсека толщиной 100 мм имелся овальный проем размером 900 на 380 мм для люка. Перед ним было небольшое отверстие, предположительно для перископа, и еще одно очень маленькое, предположительно для вентилятора.В полу прорублен круглый проем шириной 520 мм для эвакуационного люка.

Макет корпуса Maus. Обратите внимание на количество вопросительных знаков.

Моторный отсек располагался за кабиной водителя. Крыши над ним не было, но британцы подсчитали, что толщина брони здесь будет 60 мм. Двигатель предположительно устанавливался посередине отсека с топливными баками по бортам. Моторный отсек был разделен на шесть секций, но англичане не могли догадаться, для чего они предназначались.

Следующим было боевое отделение. Его крыша состояла из четырех сваренных между собой листов толщиной 60 мм. Поскольку боевое отделение было совершенно пустым, сказать о нем что-то определенное было сложно. Наконец, самый задний отсек был отведен под трансмиссию. Он был разделен на три секции бронированными переборками толщиной 20 мм. Автор доклада предполагал, что здесь будет установлена ​​электрическая трансмиссия, которую описал инженер.

Измерив корпус, англичане подсчитали, что он весил около 68 тонн.

Башня описывалась как «массивная конструкция, невероятно высокая для своей ширины и длины». Его масса без каких-либо компонентов оценивалась в 34 тонны. Его изогнутую лобовую броню сравнивали с броней «Королевского тигра», ошибочно приписывая ее дизайн доктору Порше. В передней части башни был прорезан проем для орудия, смещенный вправо от центральной оси примерно на 200 мм. Это позволило специалистам оценить размеры маски орудия. Пол башни был сварен из двух листов толщиной 93 мм с локальными слабыми местами.В верхней части башни было прорезано круглое отверстие шириной 35 см, а в корме — круглое отверстие шириной 25 см. Поскольку ни один из них не был достаточно большим для люка, автор отчета предположил, что корпуса и башни были отправлены в Меппен до того, как они были полностью вырезаны.

Чертеж всех известных частей Maus, собранных вместе. У англичан не было информации о конструкции ходовой части и маски орудия.

Броня танка только прокатана. Было трудно измерить толщину таких толстых пластин, но измерения, сделанные британскими специалистами, не отличались заметно от тех, которые позже сделали советские.

Орудия, предназначенные для Maus, тестировались отдельно. На 12,8 cm KwK 82 L/55 дульный тормоз не устанавливался, но автор не исключил возможность нахождения позже других стволов с резьбой для дульного тормоза. Горизонтально-скользящий затвор открывался вправо. Использовался стандартный электрический ударно-спусковой механизм. Основное орудие располагалось в левой части сдвоенной артустановки. Его пришлось сместить очень далеко назад, чтобы сбалансировать. Тормоз отката и рекуператор располагались над стволом.Общая длина составляла 7020 мм, длина нарезной части ствола — 5533 мм. Расчеты показали, что снаряд 12,8 cm PzGr 43 массой 28,3 кг будет иметь начальную скорость 750 м/с со средним зарядом метательного заряда или 920 м/с с полным зарядом.

Тот же Маус, вид сверху.

Спаренный 7,5 cm KwK 44 L/36,5 был совершенно новым, хотя автор не исключил возможности использования боеприпасов от 7,5 cm KwK L/24. Орудие также имело горизонтально-скользящий затвор, открывающийся вправо, и электрический ударно-спусковой механизм.Это орудие было размещено справа от основного орудия и могло блокировать его казенную часть при полном откате. Тормоз отката располагался под стволом, рекуператор над ним. Оба орудия имели общую люльку, изготовленную как единая литая деталь. Он крепился к передней стенке башни через выступ в лобовой части. Британцы подсчитали, что и пушки, и люлька весили не менее 5 тонн.

Используя известное соотношение веса брони и других компонентов, британцы подсчитали, что полностью сложенный Maus будет весить около 214 тонн.

После того, как исследование корпусов, башен и пушек было завершено, исследовать больше было нечего. «Маус» оставался загадкой, но дополнительных материалов для исследования не было. Другой отчет был опубликован 27 июня 1945 года, но в основном он содержал ту же информацию, собранную в мае, включая дословное цитирование показаний бетонщика. Было сделано дополнительное примечание, указывающее, что танк, вероятно, изначально имел двигатель DB 603, который позже был заменен на MB 517.Также появилась новая информация о трансмиссии. Появилась новая информация о массе танка, оказалось, что он весил всего 176,5 тонн вместо 214.


По горячим следам

К осени англичане получили информацию, прояснившую ситуацию. Приложение к сводке технической информации № 186, опубликованной 11 октября 1945 года, содержало сводку протокола встречи между Порше, Гитлером и Шпеером, состоявшейся 9 июня 1942 года.После обсуждения установки 88-мм пушки L/71 на Тигр (П) разговор перешел на танк со 128-мм или 150-мм пушкой во вращающейся башне со спаренной 75-мм пушкой или САУ со 180-мм пушкой. пушка, лоб 200 мм, борта 180 мм. Бронирование башни или каземата было бы еще более внушительным: 220 мм спереди и 200 мм по бортам. Порше рекомендовал использовать дизельный двигатель, но Шпеер был против, утверждая, что времени на его разработку нет.

Схема Daimler-Benz MB 509.

Далее следует краткое изложение истории развития Maus. Порше и его специалист по электротрансмиссии Отто Цадник решили повторно использовать ту же идею, что и на Фердинанде, но с серьезными изменениями. Вопреки желанию Шпеера, Порше решил использовать дизельный двигатель. Daimler-Benz не смог выполнить свою часть сделки. В ноябре Порше узнал, что получить двигатель вовремя не удастся. В конце концов, ему пришлось использовать бензиновый двигатель MB 509 (в документе он называется DB 509).Для этого пришлось немного изменить конструкцию трансмиссии.

В конце 1942 года немецкое артиллерийское управление назначило куратором проекта полковника Хенеля. Его работа заключалась в поездках к различным субподрядчикам, чтобы угрожать им штрафами и наказаниями, если заказы не будут выполнены вовремя. Например, Хенель появился в Штутгарте 13 декабря 1942 года и потребовал, чтобы корпус «Мауса» был готов к испытаниям к 5 мая 1943 года. Его требования не возымели действия, и его визиты считались довольно забавными.

Общий вид танка Maus.

В начале января 1943 года Порше был вызван в Берлин, чтобы показать Гитлеру модель танка. Фюреру это понравилось, но особых просьб или замечаний не сделал.

К 12 января работа разделилась следующим образом. Krupp отвечал за корпуса и башни, Daimler-Benz строил двигатель, Siemens-Schuckert собирал электрические компоненты, а Skoda занималась подвеской и ходовой частью.Окончательная сборка будет происходить на заводе Alkett.

Работа началась, но бурное обсуждение продолжалось. Генрих Книпкамп был категорически против этой конструкции, утверждая, что она будет слишком ненадежной. Полковник Хенель, с другой стороны, пытался добавить в конструкцию больше возможностей, утверждая, что танк обязательно должен иметь огнемет с топливным баком на 1000 л. Расчет веса охладил энтузиазм полковника. Огнемет значительно утяжелил бы и без того перетяжеленный танк.Помимо артустановки пришлось бы переделывать подвеску. В последних немецких разработках уже использовались торсионы, но Порше не хотел рисковать. Он заказал у Шкоды простую винтовую пружинную подвеску.

Подвесная тележка и сегмент гусеницы.

Система охлаждения была испытана в Штутгартском техническом институте под руководством профессора Камма. Его эффективность признана удовлетворительной.

Работа шла полным ходом.Шпеер прибыл в Штутгарт 6 апреля 1943 года и в течение получаса осматривал модель танка. 10 апреля поступил приказ перевезти модель в Берлин, чтобы показать ее Гитлеру, но 16 апреля он был отменен. 14 мая Гитлер наконец-то смог лично увидеть модель. Увидев танк, он заметил, что он похож на детскую игрушку, и приказал установить 150-мм орудие. Автор доклада выразил сомнение, что Гитлер отдал бы такой приказ чисто из эстетических соображений, но разработка 150-мм пушки для «Мауса» действительно велась.

Звено гусеницы Maus.

Двигатель MB 509 прибыл в Штутгарт 16 июля, когда система охлаждения была готова. По общему мнению, переделка двигателя с авиационного образца на танковый не представляла особого труда, но все же было принято решение собрать второй прототип Maus с морским дизелем MB 517.

Казалось, все идет хорошо. Алкетт начал сборку первого прототипа 1 августа 1943 года, когда пришли первые плохие новости.Крупп не смог бы уложиться в сроки из-за сильных бомбардировок. Первый корпус был закончен к середине сентября, но осень 1943 года оказалась для Maus роковой. На встрече с Porsche в Берлине 27 октября Шпеер объявил, что серийное производство производиться не будет. Тем не менее работы над «Маусом I» с бензиновым двигателем МВ 509 и «Маусом II» с дизелем МВ 517 продолжались.

Американский солдат на заводе Krupp измеряет размеры корпуса Maus.Бомбардировка заводов-субподрядчиков уничтожила проект.

Танк Maus (конкретная машина в документе не указана, но это был Maus I) вышел на испытания 23 декабря 1943 года. Поскольку башня еще не прибыла, вместо нее был установлен макетный груз массой 55 тонн. На испытаниях ломались пружины подвески, из-за низкого качества металла быстро ржавели выхлопные трубы, были проблемы с электротрансмиссией. Тем не менее, испытания были признаны успешными, и танк отправили в Бёблинген для дальнейших испытаний.

Танк прибыл на полигон 10 января 1944 года. Хорошо показал себя при личном управлении Отто Цадником. Свидетели утверждали, что он был способен на любой маневр, который мог осуществить танк «Пантера». Конечно, это не включало максимальную скорость. Колосс мог развивать скорость только в 22 км/ч на хорошей местности. Гитлер приказал к июню установить на «Маус» настоящую башню.

Схема башни Maus в собранном виде (слева) и с перспективным дальномером (справа).

Турель прибыла 3 мая. Орудие, механизм наведения и другие компоненты прибыли через несколько дней, а сборка была завершена к 9 июня. Последующие испытания показали улучшение подвижности, так как башня стала немного легче 55-тонного макета. Танк оставался в Бёблингене до начала октября, когда был отдан приказ перебросить его в Куммерсдорф.

Тем временем работа над Maus II продолжалась. Танк прибыл в Бёблинген 20 марта 1944 года. Двигатель был готов только в сентябре.Стендовые испытания показали впечатляющие результаты. Двигатель прибыл в Бёблинген в начале октября. Его сразу установили в танк, который без дополнительных испытаний отправили в Куммерсдорф. Это было ошибкой. Вал сломался, как только танк запустили в Куммерсдорфе, вероятно, из-за плохой сборки. Крепление двигателя ослабло при транспортировке, что привело к его смещению и поломке.

Корпус Maus на заводе Krupp.

Новый MB 517 прибыл в Куммерсдорф только в марте 1945 года. Команда техников, посланная Porsche, вернулась в Штутгарт 3 апреля. Они сообщили, что двигатель был успешно запущен, но танк не сдвинулся с места. Насколько британцам было известно, оба танка все еще находились в Куммерсдорфе, когда Германия капитулировала.


Случайный разговор

Поскольку Куммерсдорф попал в зону советской оккупации, у англичан не было шансов получить танк Maus для испытаний. Тем не менее заводы и специалисты, принимавшие участие в создании танка, все же были доступны.

Башня танка Maus на заводе Krupp.

Допрос персонала Круппа в Эссене и осмотр частично собранных корпусов дали много информации о проекте. Немцы заявили, что корпус и башня были разработаны фирмой Krupp в июне 1942 года, а производство началось в мае 1943 года. Маус.Несмотря на то, что толщина брони была занижена, масса танка была указана как «примерно 200 тонн». На основании информации, собранной на заводе, Крупп построил три комплекта брони. Один был отправлен для испытаний на проникновение, остальные остались на заводе.

Работа с американцами принесла больше плодов. Отчет CIOS (Подкомитет по объединенным разведывательным задачам) о работе, выполненной доктором Порше во время войны, содержал большое количество информации о танке Maus, включая чертежи.

Схема в разрезе. Несмотря на колоссальные размеры танка, внутри было очень мало места.

Допрос Порше дал очень интересные результаты. По его словам, танк был запущен в серию. В отчете отмечалось, что Шпеер, Хайдекампф и другие высокопоставленные сотрудники не согласны с этой оценкой. Порше описал свое детище как «мобильный бункер», однако автор доклада указал, что несколько танков «Тигр» или «Пантера» будут стоить примерно столько же, сколько один «Маус», но будут гораздо эффективнее даже в чисто оборонительной роли.

Обозначение «мобильный бункер» хорошо описывало танк. При толщине лобовой брони до 350 мм его максимальная скорость составляла всего 20 км/ч. Это значительно упростило конструкцию подвески. Чтобы такой дорогой танк не подорвался на минах, его нужно было защищать еще и снизу. Для его перевозки должна быть спроектирована специальная железнодорожная платформа.

Схема подвески Maus.

Поскольку мостов, способных перевезти этого монстра, было немного, танк должен был иметь возможность пересекать реки глубиной до 7-9 метров под водой.Разработанный немцами механизм охарактеризовали как «оригинальный, но не очень практичный». Поскольку танк не мог развивать полную мощность двигателя, используя только воздух, подаваемый по шлангу, немцы нашли другой способ. Один «Маус» остался на суше и снабжал электрическим током второй «Маус», который преодолел препятствие, после чего их роли поменялись местами. Подготовка к этой процедуре заняла 45 минут, за это время экипажи должны были покинуть свои машины. Оба берега реки должны были быть тщательно подготовлены.Поскольку «Маус» должен был сражаться при поддержке более легких танков, это посчитали приемлемым. Осмотр конструкции люка показал, что только механик-водитель и радист имели шанс спастись из машины в случае ее поломки под водой.

Porsche также дал точный вес танка (184,4 тонны) и его компонентов. 41,8% общей массы приходилось на броню. Для сравнения, Черчилль III использовал 40,7% своей массы для брони, а Кромвель только 34,7%. 16% массы пришлось на подвеску и ходовую часть по сравнению с 21%.0% и 25,7% соответственно. Масса массивной трансмиссии была пропорционально сопоставима с массой британских танков: 7,9%, 7,0% и 7,4% соответственно.

В турели башни установлен частично механизированный готовый стеллаж.

На вооружение приходилось больший процент массы: 27,5% против 14,3% и 19,3% у британских танков. Башня, вооружение и боекомплект весили около 50 тонн. Это усложняло работу механизма поворота, тем более, что башня сильно разбалансировалась.Было видно, что на первое место конструкторы ставили броню и вооружение, все остальное было второстепенным.

Поскольку Порше не принимал непосредственного участия в разработке вооружения, его описание содержало ряд ошибок. Например, Порше заявил, что спаренная 75-мм пушка идентична той, что использовалась на Pz.Kpfw.IV. Порше также упомянул, что основное орудие может быть заменено 150-мм пушкой L/38, но точной информации у него нет.

Длина отката орудия 128 мм L/55 составляла 960 мм.Он уравновешивался противовесом. По словам Порше, размещение пулеметов было неудачным из-за тесной башни, но места для разработки лучшей установки не хватило.

Боеукладка в корпусе. Трудно ответить на вопрос, как заряжающий будет доставлять огромные снаряды в башню, чтобы пополнить готовую стойку.

Поскольку подъем 56-кг 128-мм или 70-кг 150-мм выстрелов вручную был невозможен, был разработан механизм заряжания, но для его работы требовалось два заряжающих.Если бы устанавливалась 150-мм пушка, то пришлось бы использовать двухсекционные боеприпасы. В танк вмещалось 60 или 68 (в зависимости от источника) выстрелов калибра 128 мм и 200 выстрелов калибра 75 мм. Ожидаемое количество 150-мм снарядов неизвестно. Порше ничего не знал о прицеле, но сказал, что планируется установить дальномер.

Англо-американская комиссия также получила результаты испытаний. Танк мог преодолевать стену высотой 0,72 м и траншею шириной 4,5 м. При средней скорости 16 км/ч дальность полета с подвесным топливным баком составляла 190 км.Система охлаждения была большой проблемой. Несмотря на то, что вентиляторы забрали у двигателя колоссальные 148 л.с., моторы перегревались после 15 минут работы на максимальной мощности.

Расчетная нагрузка на каждое опорное колесо.

Maus был действительно единственным в своем роде. Создавая свой «мобильный бункер», Фердинанд Порше применил множество уникальных решений, как сомнительных, так и гениальных. Тем не менее победители Великой Отечественной войны мало интересовались его творчеством. И у англичан, и у американцев уже был опыт постройки медленных и тяжелобронированных бегемотов, и то и другое закончилось плачевно. Несмотря на то, что Maus был новым для британской и американской разведки, машина базировалась на технических решениях, разработанных в 1942-1943 годах, и была слишком стара, чтобы по-настоящему впечатлять.


Перевод Петра Самсонова

warspot.net

Источники:
  • Отчет о расследовании деятельности доктора В.Инж. ч.к. Ф. Порше, К.Г.
  • Заключительный отчет БИОС №614, Позиция №18, Проектирование сварки и изготовление корпусов и башен немецких танков
  • Отчет об оценке CIOS № 244 — Испытательный полигон Henschel Tank
  • Архив канадского военного штаба, Лондон (1939-1947) RG 24 C 2
  • Пашолок, И. Желтов, Panzerkampfwagen Maus — М.: «Тактическая пресса», 2012
  • https://warspot.net/187-the-elusive-maus

6 лучших клеток для домашних мышей в 2022 году — обзоры и лучший выбор

Поиск подходящей клетки для мышей — один из самых важных аспектов ухода за ними. Мыши — разумные существа и способны даже на сложные эмоции, такие как любовь. Им нужно место, где они могут чувствовать себя в безопасности, дом внутри вашего дома, который они могли бы назвать своим.

Клетка для вашей мыши может быть самой разнообразной планировки, материалов и размеров. Сортировка выбора может занять некоторое время, и даже в этом случае вы можете не получить долговечный и высококачественный продукт.

Если вы хотите предоставить своей мыши удобное место, которое она может назвать домом, не тратя бесчисленные часы на поиски в Интернете, вы попали в нужное место.Мы составили список подробных обзоров шести лучших продуктов 2021 года, чтобы помочь вам сузить выбор.

Быстрое сравнение наших любимых

6 лучших клеток для мышей – отзывы 2022 г.

1. Клетка для мышей Ferplast Favola — лучший результат

Клетка Ferplast Favola предназначена для всех видов мелких пушистых грызунов, включая мышей и хомячков. Клетка предназначена для того, чтобы дать им веселое место для игр и место, где они могут расслабиться или спрятаться, когда они хотят побыть в одиночестве.Модульную клетку также можно прикрепить к другим клеткам, чтобы увеличить размер среды обитания вашей мыши, что особенно полезно, если у вас более одной мыши.

Эта клетка от Ferplast состоит из проволочной сетки в верхней части и прозрачной нижней части. Это позволяет вам наполнить его опилками или стружкой, давая вашей мыши пространство для рытья и создания небольших гнезд, как они обычно делают в дикой природе. Верхняя и нижняя области соединяются лестницей, поэтому ваша мышь может иметь отдельные пространства для сна и отдыха, еды и игр.

Размеры клетки: 23,62 дюйма в длину, 14,37 дюйма в ширину и 11,81 дюйма в высоту. Он весит всего 6,37 фунта, что упрощает перемещение из космоса в космос при необходимости. Чтобы почистить клетку, легко откройте верхнюю дверцу или отсоедините основание от проволочной сетки.

В клетку входят аксессуары, необходимые для комфортной жизни. К ним относятся гнездо, колесо для упражнений, поилка со стальным носиком и миска для кормления. Не все аксессуары изготовлены по таким высоким стандартам, как сама клетка.

  • Прикрепляется к другим клеткам для улучшения среды обитания
  • Верхняя и нижняя части для жилых помещений
  • Поставляется со многими аксессуарами
  • Аксессуары более низкого качества в комплекте с клеткой

2. Клетка для мелких животных с защитой от жевания — лучшее соотношение цены и качества

Клетка для мелких животных Ware Chew Proof имеет четырехъярусную конструкцию, предназначенную для того, чтобы дать вашим мышам пространство для ползания вверх и вниз, как если бы они копались в своей среде обитания.Основная часть клетки изготовлена ​​из металлической сетки. Металл прочен и покрыт порошковой краской, чтобы защитить его от поедания мышами.

Нижний дюйм клетки представляет собой металлический поддон. Этот поддон легко отсоединяется и присоединяется к основной части клетки для быстрой очистки. По всему корпусу расположены различные полки и пандусы. Вы можете прикрепить их в разных конфигурациях сбоку от проволочной клетки, чтобы переключить вещи для ваших бесстрашных исследователей.

Конструкция включает в себя две большие дверцы для доступа внутрь клетки, расположенные на одной стороне клетки и примерно одинакового размера.Вся клетка довольно большая: 24 дюйма в высоту, 17 дюймов в длину и 12,75 дюймов в ширину. Ее легко собрать при доставке, и, что самое приятное, это одна из лучших клеток для мышей за свои деньги. Он не поставляется с другими аксессуарами, кроме лестниц и пандусов.

  • Легкий доступ через две двери
  • Лучший бюджетный вариант
  • Прочная металлическая сетка и пандусы
  • Не лучшее качество
  • Без дополнительных принадлежностей

3.

Prevue Pet Products 528 Клетка для мелких животных — выбор премиум-класса

Часто владельцы грызунов предпочитают иметь более короткие клетки для мелких животных, таких как мыши, чтобы они не упали со слишком большой высоты. Эта клетка от Prevue Pet Products предлагает вам большое пространство для приседаний, чтобы обеспечить безопасность ваших мышей, но при этом дать им достаточно места для бега. Размеры клетки составляют 32,5 дюйма в длину, 19 дюймов в ширину и 17,5 дюймов в высоту. Клетка немного тяжелее — 14 фунтов, потому что в конструкции используются прочные и долговечные материалы.

Эта клетка разделена на две половины, с проволочной сеткой сверху и толстым пластиковым дном. Между каждым из проводов всего ⅜ дюйма, поэтому мыши не могут протиснуться и убежать. Основание высотой 6 ¼ дюймов может быть заполнено удобной подстилкой, чтобы дать вашим мышам возможность зарыться и сделать гнездо.

В комплекте с клеткой идет одна лестница и полка. В отличие от других, более дешевых клеток, здесь нет риска падения, когда ваши мыши играют на них, поскольку пластиковые винты надежно прикреплены к боковым сторонам проволочной сетки. Нижняя часть отсоединяется для удобной очистки, и есть две большие входные двери, одна в верхней части клетки, а другая сбоку.

  • Надежно закрепленные аксессуары
  • Прочные материалы во всей конструкции
  • Тонкие зазоры между проводами для надежной фиксации мышей
  • Дороже других

4. Клетка для мелких животных AmazonBasics

 

Компания Amazon Basics разработала собственный вариант клетки для маленьких животных на основе отзывов клиентов об аналогичных продуктах.Эта среда обитания включает в себя несколько аксессуаров и построена из прочного пластика и металлической сетки. Клетка отличного размера для ваших мышей: 32 дюйма в длину, 18 дюймов в высоту и 22 дюйма в ширину.

Клетка поставляется с множеством аксессуаров для среды обитания. Не все они соответствуют чрезвычайно высоким стандартам, но они дополняют клетку и повышают ее общую ценность. Аксессуары включают в себя бутылку для воды без капель, защиту для сена, надежно запираемый балкон с ведущим пандусом и тарелку для еды с защитой от опрокидывания.На клетку также распространяется ограниченная годовая гарантия Amazon Basics.

Есть также два других размера, в зависимости от того, сколько у вас мышей или для более крупных грызунов. Размер, указанный здесь, является стандартным размером, но он также поставляется в размерах Jumbo и Large. Есть два простых способа получить доступ к внутренней части и очистить ее. Вся верхняя часть клетки может открываться или небольшие двери могут открываться спереди.

  • Включает аксессуары
  • Два больших отверстия
  • Ограниченная гарантия сроком на 1 год
  • Аксессуары не всегда соответствуют самым высоким стандартам

5.Клетка для аркадной мыши Midwest Critterville

 

Клетка от Midwest Critterville представляет собой интересное сочетание безопасного домашнего пространства, в котором ваши мыши могут отдохнуть и расслабиться, и игровой аркады, в которую они могут залезть в любое время. Нижняя часть клетки сделана из проволочной сетки и нижнего куска пластика, который можно заполнить подстилкой, чтобы сделать ее более удобной.

Верхняя часть клетки вертикальная и тонкая. Там есть трубка, через которую ваша мышь может пролезть, чтобы попасть в эту часть клетки, и начать свою забавную тренировку.Оттуда вертикальная часть клетки ведет вверх по пандусам и балконам. Ближе кверху они могут получить доступ к колесу для упражнений, и вы можете наблюдать за их тренировкой через прозрачный пластик. Поднявшись еще на один пандус, они попадут в зону гнездования, которая закрыта, за исключением входного отверстия.

Помимо матраца и колеса для упражнений, клетка также поставляется с миской для корма и бутылкой для воды. Клетку можно комбинировать с другими клетками, чтобы улучшить их среду обитания.Вся клетка весит 6,1 фунта, а ее размеры составляют 18,1 на 11,4 на 21,5 дюйма. Он также поставляется с гарантией качества MidWest и годовой гарантией производителя.

  • Много места для исследования
  • Большой размер
  • Поставляется с принадлежностями
  • Установка затрудняет очистку

6.

Топпер на майку You & Me Small Animal High Rise

 

Эта клетка от You & Me — отличный способ расширить среду обитания вашей мыши.Это топпер и не предназначен для использования сам по себе. Вместо этого вы устанавливаете эту клетку в форме домика поверх аквариума, как аквариум. Затем он увеличивает количество уровней и областей, которые ваша мышь может назвать своими.

Клетка имеет несколько пандусов и в основном изготовлена ​​из тонкой проволочной сетки. Для вашего входа предусмотрена удобная верхняя дверца, хотя вам придется снять всю верхнюю часть, чтобы очистить внутреннюю часть. Если размер клетки не идеально подходит для аквариума, может быть сложно заставить их поместиться друг на друга.Некоторые клиенты рекомендуют использовать стяжки, чтобы части клетки подходили друг к другу.

Клетка предназначена для того, чтобы стать простым дополнением к уже имеющейся у вас галлоновой емкости. Он не поставляется с какими-либо собственными аксессуарами, за исключением небольшого балконного пространства и пары проволочных пандусов, чтобы ваши мыши могли перемещаться между уровнями. Некоторым мышам может быть трудно забраться на проводку, а у других нет никаких проблем.

  • Прочная проволочная сетка
  • Простая конструкция
  • Небольшая доступность
  • Не всегда стабильно

Руководство покупателя

Купить клетку для мыши не составит труда.Вы также можете переключить его, если хотите, чтобы они получили другую конфигурацию или новое пространство для исследования. Однако они, как правило, чувствуют себя в большей безопасности, когда находятся в похожем пространстве с похожими игрушками и аксессуарами. Выбрать один и постоянно улучшать его, чтобы сделать его более увлекательным или разнообразным, как правило, лучший способ обустроить свой дом.

Размер клетки

Размер клетки важен, особенно если у вас не так много времени, чтобы позволить им свободно бегать по большому пространству в вашем доме. Хорошее эмпирическое правило заключается в том, что одной мыши требуется не менее 10 галлонов пространства в аквариуме. Для каждой мыши после этого вы должны увеличить размер на 5 галлонов.

Правильно подобранная клетка поможет им дольше оставаться здоровыми и счастливыми вместе. Чем больше они смогут имитировать свой образ жизни в дикой природе, за вычетом страха перед хищниками, тем лучше они будут.

Предоставлено: Курит Афшен, Shutterstock

Безопасность

Одной из целей клетки является предоставление вашей мыши безопасного пространства, которое они могут назвать своим домом. В хорошей клетке для мышей должно быть место, где они могут гнездиться и зарываться в подстилку.Вы не хотите, чтобы нижний лоток был слишком коротким. Тонкий слой постельных принадлежностей не позволяет им зарыться внутрь и не выполняет общую функцию, для которой он предназначен.

Даже если в вашей клетке нет скворечника, вы сможете установить его сбоку. Клеткам, которые поставляются со скворечниками, следует уделить особое внимание, потому что они уменьшают потребность в их покупке. Скворечники особенно важны, если вы хотите разводить мышей.

Материалы

Обычно клетка для грызунов изготавливается из двух основных материалов, включая металлическую сетку или проволоку, образующую тонкие прямоугольники по всей поверхности клетки, и толстое пластиковое дно.Мыши любят что-то грызть, поэтому вам нужно убедиться, что любой металл или порошковое покрытие, используемое снаружи, безопасно для них.

Другим соображением является качество клетки. Есть ли балконы и пандус? Если да, остаются ли они на месте или падают или разваливаются каждый раз, когда по ним начинает карабкаться маленькая мышка?

Изображение предоставлено: Pixabay

Аксессуары и модификации

Клетка не всегда должна состоять из простого куска металлической проволоки и пластикового контейнера на дне.Он может включать в себя модификации, которые позволяют ему прикрепляться к другим клеткам, чтобы вы улучшили среду обитания вашей клетки. Он также не всегда находится низко над землей, но может выдвигаться вертикально, чтобы дать вашей мыши больше места для лазания.

Другим соображением должны быть аксессуары, поставляемые с клеткой, и их качество. Высококачественные аксессуары могут значительно повысить ценность клетки вашей мыши, в то время как клетка, которая стоит дороже, но поставляется с дешевыми, хлипкими аксессуарами, не стоит своих денег.

Более дешевые аксессуары также могут подвергнуть вашу мышь опасности, если они попадут внутрь и развалятся. Обязательно проверьте их на наличие слабых мест, прежде чем позволить вашей мыши исследовать новое пространство дальше. Общие аксессуары, которые поставляются с клетками, включают бутылки с водой, тарелки для еды, скворечники и колеса для упражнений.

Доступность

Наконец, обратите внимание на доступность как для вас, так и для вашей мыши. Чтобы они были здоровы, нужно содержать их клетку в чистоте. Мыши предпочитают жить в чистых местах и ​​не ценят это, когда пытаются зарыться и натыкаются на собственные экскременты.Клетка, которую трудно чистить, усложняет вашу повседневную работу и снижает вероятность того, что вы будете продолжать в том же духе.

Вы также должны учитывать, насколько доступны другие части клетки для вашей мыши, и могут ли они сбежать откуда-либо. Как далеко друг от друга промежутки в проводке, и есть ли какие-нибудь подъезды, из которых им легко выбраться?

Заключение

Лучшими клетками для мышей являются те, в которых вашей мыши или мышам достаточно места для упражнений, исследований и отдыха.Они должны чувствовать себя в полной безопасности и чувствовать, что у них есть личное пространство. Если вы хотите, чтобы они спаривались, есть дополнительные соображения о том, как вы должны расположить клетку, подстилку и аксессуары, которые вам понадобятся.

Если вы ищете хорошую клетку, в которую легко поместятся ваши мыши и в которой им будет интересно жить и играть, клетка для мышей Favola от Ferplast — лучший выбор. Он поставляется с аксессуарами, которые улучшают среду обитания вашей мыши и обеспечивают доступ, который вам нужен, чтобы облегчить чистку клетки или вынос мышей.

Навигация среди сотен вариантов и возможностей, касающихся индустрии домашних животных, может быть сложной задачей, но мы надеемся, что наши обзоры лучших клеток для мышей в 2021 году сделали это проще.

Мини-мышь, иначе известная… — Консоль World of Tanks

У меня было всего 4 премиумных танка, на которых я играл.

Pz.Kpfw. II Ausf. J: Имеет смехотворно хорошую броню для уровня 3, с хорошей скоростью и обращением с оружием. На третьем уровне эту штуку практически невозможно убить. Тем не менее, он полагается на спам премиум-боеприпасов.Стандартное проникновение AP довольно низкое. Пятый уровень он не увидит, а четвёртый разорвёт в клочья.

Valentine II: Еще один танк с хорошей броней для своего уровня. Благодаря 65-миллиметровому корпусу для уровня IV вам не нужно поворачивать корпус к врагу. Он всегда будет на вершине уровня, но это танк, который сильно зависит от спама премиум-боеприпасов. У АП плохое проникновение. Несмотря на то, что он никогда не увидит пятого уровня, есть некоторые люди четвертого уровня, которые любят полакомиться этим танком (Матильды и Хетцеры — главные угрозы).

E25: Один из самых маленьких, быстрых и один из лучших камуфляжей в игре. Этот танк идеально подходит для разведывательной работы. У него скорострельное 75-мм орудие (у меня оно стреляло каждые 2,53 секунды) и одно из лучших, если не лучшее, стреляющее и остающееся незамеченным. Благодаря чрезвычайно низкому профилю (как у ELC AMX) даже небольшие кусты скроют этот танк от врагов, и им придется приблизиться на 45 м, чтобы заметить этого маленького парня. Этот танк увидит только VIII уровень. Единственный существенный недостаток этого танка, он вообще не любит попаданий и обстрелов.Хороший доход по кредиту.

Jagdtiger 88: Несмотря на то, что он медленный и не такой подвижный, как JT IX уровня, это все же танк IX уровня, переведенный на VIII уровень. Учитывая 88-мм пробитие с хорошим для VIII уровня (203 мм) пробитием и невероятно хорошей точностью (0,31), этому танку редко приходится стрелять премиумом. Броня корпуса такая же прочная, как и у Tiger II, но именно каземат делает этот танк по-настоящему сияющим. Все серебряные раунды VIII и IX уровней не пройдут (при условии, что они выпадают в среднем). В меня стреляли по каземату из БЛ10 (пробитие 286 мм) в упор, и она отскочила.Он быстро стал одним из моих любимых танков. В качестве бонуса этот танк не увидит X уровень и имеет безумный доход в кредитах (я заработал 152к на проигрыше). Снимаю шляпу перед фашистским немецким коробчатым танком.

Немецкий сверхтяжелый танк времен Второй мировой войны Maus V2 от Takom в масштабе 1/35.

Компания Takom снова шокировала нас своим новым выпуском не одного, а двух сверхтяжелых танков Maus в 35-м масштабе. Мы начали строительство версии танка с башней «V2», в первую очередь, мы подумали, что вы хотели бы увидеть, что входит в коробку, прежде чем мы ее построим.

Немецкий сверхтяжелый танк Maus V2 времен Второй мировой войны 

Масштаб 1/35

Код продукта № O2050

Три маркировки включены из AMMO

включает рабочие траки

Детали фототравление включены

Zwei Maus Lose im Haus von Takom

Мы знаем, что существует более старый комплект Cyberhobby этой массивной машины и, по-видимому, запланированная будущая версия Maus с полным интерьером от Trumpeter, но с тех пор было больше доступа к единственному образцу этого танка — но теперь Takom на высоте не только одним, но и ДВУМЯ новыми комплектами Maus в 35-м масштабе.

Немного об этом танковом монстре для тех, кто мало о нем знает: SdKfz 205 Panzerkampfwagen VIII (PzKpfW VIII) «Maus»:

Самым тяжелым из когда-либо созданных танков был немецкий Panzer VIII. Его конструкторы не были лишены чувства юмора — они назвали 180-тонного бегемота «Маус» (Мышь). Если бы завод по производству Maus не подвергся бомбардировке союзниками и впоследствии не был захвачен Советами в 1945 году, немцы построили бы больше, чем единственный полностью рабочий прототип.Maus был предназначен для проделывания брешей в обороне противника наподобие огромного «танка прорыва», при этом почти не получая повреждений ни для каких компонентов или экипажа внутри.

Полный автомобиль имел длину 10,2 метра (33 фута 6 дюймов), ширину 3,71 метра (12 футов 2 дюйма) и высоту 3,63 метра (11,9 фута). При массе 188 метрических тонн основным вооружением Maus была разработанная Круппом 128-мм пушка KwK 44 L/55, созданная на основе 12,8-см противотанковой полевой артиллерийской установки Pak 44, также использовавшейся в истребителе танков казематного типа Jagdtiger, со спаренным 75-мм KwK 44 L/36. 5 пистолет. 128-мм пушка была достаточно мощной, чтобы уничтожить все боевые бронированные машины союзников, ранее находившиеся на вооружении, некоторые на дальности более 3500 метров (3800 ярдов)

Броня передней части корпуса имела толщину 220 миллиметров (8,7 дюйма), борта и корма корпуса — до 190 миллиметров (7,5 дюйма). Броня башни была еще толще, лоб башни составлял до 240 миллиметров (9,4 дюйма), а борта и корма — 200 миллиметров (7,9 дюйма). Маска орудия составляла 250 миллиметров (9,8 дюйма), а в сочетании с броней башни сзади уровень защиты в этой части был еще выше.

Вообще-то немцы построили ДВА танка Маус. Один (V1) с башней, а другой (V2) без башни. Эти двое прошли испытания в конце 1944 года.

Первый безбашенный прототип (V1) был собран компанией Alkett в декабре 1943 года. В том же месяце начались испытания макета башни того же веса, что и настоящая башня. В июне 1944 года серийная башня с вооружением была использована для испытаний.

Maus был слишком тяжелым, чтобы пересекать мосты. В результате была разработана альтернативная система, в которой Maus вместо этого переходил вброд реки, которые ему нужно было пересечь.Из-за своих размеров он мог переходить вброд относительно глубокие потоки, но для более глубоких он должен был погружаться и передвигаться по дну реки. Решение требовало, чтобы танки были соединены в пару. Один Maus будет подавать электроэнергию на пересекающее транспортное средство по кабелю, пока оно не достигнет другой стороны. Экипаж получал воздух через большую трубку, которая была достаточно длинной, чтобы танк мог уйти под воду на 7,9 м (26 футов).

Prototype V2 (данный комплект)

В марте 1944 года был доставлен второй прототип V2.Он отличался многими деталями от прототипа V1. В середине 1944 года прототип V2 был оснащен силовой установкой и первой серийной башней Maus. Эта башня была оснащена 128-мм пушкой KwK 44 L/55, спаренной с ней 75-мм пушкой KwK 44 L/36,5 и спаренной с ней 7,92-мм MG 34. Предполагалось, что прототип V1 будет оснащен второй произведенной башней, но этого так и не произошло. случилось.

К июлю 1944 года Krupp производил еще четыре корпуса Maus, но им было приказано остановить производство и утилизировать их.Крупп прекратил все работы над ним в августе 1944 года. Тем временем в сентябре 1944 года начались испытания прототипа V2, оснащенного дизельным двигателем Daimler-Benz MB 517, новой электрической системой рулевого управления и ходовой частью и гусеницами, разработанными Skoda Works. Был также специальный железнодорожный вагон, сделанный специально для перевозки прототипов Maus.

В действии:

Рабочие прототипы Maus остались в Куммерсдорфе после испытаний в Бёблингене. Maus V2 был заказан в Вюнсдорфе для охраны ОКХ, вероятно, там был заказан V1, а также в качестве поддержки для V2, если он въезжал в грязь или для помощи при движении по рекам (где он служил бы генератором для V2).V2 заканчивался на Гинденбургплац, перед бункером Maybach I, где он был уничтожен немцами, заложив заряды в моторном и боевом отделениях. Поскольку под башней у него были уложены боеприпасы, он был поврежден больше, чем V1, при этом башня была более или менее цела. Maus V1 не достиг этого района.

Маус, восстановленный Советским Союзом, взорван в очень плачевном состоянии в 1945 г.

Башня крупным планом:

Maus был настолько тяжелым, что для его перемещения потребовалось шесть полугусениц, стянутых вместе:

В большинстве отчетов Maus говорится, что эта башня была размещена на корпусе V1 Maus и доставлена ​​в Кубинку на танковый полигон в России.

Это он в вагоне для перевозки обратно в Россию.

Единственный уцелевший Maus, который, как мы думаем, был сделан из комбинации частей двух разных танков, и практически без внутренней отделки, теперь выставлен в Музее Кубинки в Russia Today с новой окраской.

Этот набор, Немецкий сверхтяжелый танк Maus V2 времен Второй мировой войны в масштабе 1/10 от Takom:
На коробке, как обычно, есть красивые арты от takom. Это коробка обычного размера, которую вы вполне можете увидеть с танком размера King Tiger или Tiger.Коробка открывается, чтобы увидеть большую почти полную башню среди шестнадцати литников из того квадратного серого пластика с толстыми литниками, которые использует Таком. однако точки соединения тонкие, и удаление не было проблемой. На пластике внутри есть следы швов, которые нужно удалить, но ничего сложного, и все следы выбрасывателя находятся в скрытых местах. Тогда хорошая инженерная работа над пластиком…
Инструкции:
К этому набору прилагается простой набор инструкций всего для двенадцати этапов сборки.Обычный стиль с таким, черно-белым и простыми шагами. Здесь ничего не зажато, и за ними легко следить. Однако дьявол кроется в деталях, так как некоторые из этих шагов включают в себя создание нескольких объектов, например, подвески на шаге  2: Их двенадцать и двадцать четыре. Вместе с треками в начале этого комплекта много повторений.
Пока мы все еще смотрим на инструкции, есть три полноцветных полностраничных профиля в версиях «что, если», предоставленных AMMO с, конечно, их собственными красками, указанными как цвета. Это хорошая отправная точка, а поскольку этот танк так и не был запущен в серийное производство, то свобода, которую модельер имеет в создании собственной цветовой схемы, поражает воображение.

Популярными будут схема красного оксида и камуфляжный стиль «Осьминог» с бокс-арта, есть много способов, которыми модельер может продемонстрировать этот комплект после завершения — частично разрушенный или в рабочем состоянии на поздней войне / ’46 » поле битвы. Если бы у вас было двенадцать или около того полугусениц, вы могли бы даже показать, как его буксируют, вы могли бы показать реальную восстановленную версию.

В этом наборе есть небольшой лист с декалями , на котором изображены серп и молот Мауса, которые на самом деле применялись немцами в надежде, что любое просочившееся изображение, полученное разведывательными службами США или Великобритании, сочтет, что это был Советский танк — бредовая логика да?
В комплекте один лист латуни фототравление . Отсутствие этого обнадеживает и совершенно разумно, так как все, что видно на комплекте, выглядит довольно коренастым. Более крупные детали на фототравлении — это решетки двигателя.

Итак, переходим к пластику — мы пройдемся по этому набору, литник за литником, прежде чем приступить к сборке модели.

Литник F (X3) траки — это большие пластины, которые являются внутренними соединительными частями трака Maus. Этих литников три, с небольшим количеством соединительных точек на каждом, поэтому много повторений, хотя Таком сделал эти точки минимальными по размеру.

Крупный план показывает крошечные 2-миллиметровые следы выталкивающего штифта на всех них, однако вам не нужно о них беспокоиться, поскольку они полностью скрыты внутри механизма гусеницы.

Литник G (X3) Трекпады — эти большие колодки немного отличаются от треков V1, и есть три литника, снова заполненных этими малышами.

Для их закрепления требуется клей, однако они полностью работоспособны, когда скреплены вместе.

В совокупности каждый из рабочих треков состоит из четырех частей. Они БОЛЬШИЕ в 35-м масштабе, и преимущество в том, как они были сделаны, заключается в том, что они очень гибкие и работоспособные после сборки. Инструкции требуют 155 гусениц с каждой стороны, однако, если вы склонны, вам нужно сделать только нижний ряд гвоздей, так как массивные стальные боковые юбки скрывают верхний уровень гусениц.Выбор за вами — но это совсем не было «притиркой»…

Литник W (X2) Это средние опорные катки и ходовая часть. Опять же, они немного отличаются от колес версии V1. Они предназначены для крепления к подвеске с возможностью поворота. Хотя это своего рода уловка для большинства моделистов, нас интересует именно качество колес.

На крупном плане вы можете увидеть множество колес, прикрепленных в четырех точках, которые легко снимаются, не беспокоясь о повреждении открытых поверхностей.Это много повторений, конечно, в отличие от гусениц, но они должны быть полностью исправлены, так как должны присутствовать несколько узлов подвески под Maus.

Литник T (X2) содержит множество рычагов подвески ходовой части. Два литника полны этих маленьких гадов. В этом литнике также находятся ведущая звездочка и возвратное колесо ходовой части.

Крупный план всех деталей на литнике показывает умные (но много) места крепления деталей к корпусу.Кроме того, красивые болты, которые крепятся ко всем этим колесам в 35-м масштабе. снова много повторений на этом раннем этапе сборки, но инженеры этого комплекта изо всех сил старались облегчить нам задачу.

Литник E (X2) имеет последнюю часть ходовой части. Здесь находятся шарнирные рычаги подвески, а также штифты и колпачки для колес. ничего особенно интересного, но некоторые из этих крышек будут отображаться в нижнем ряду бака, когда они будут завершены.

Более подробно…

Литник D — В этом литнике находится верхняя моторная палуба танка. Здесь вы можете увидеть текстуру шероховатой катаной стали на пластике — не слишком много и не слишком мало.

На этом литнике также есть решетки двигателя и внутренние ребра (если хотите), которые скрепляют конструкцию. Они предназначены просто для жесткости комплекта и не используются на реальном автомобиле.
Литник S — В этом литнике находятся две основные плиты боковых юбок. Огромный и массивно толстобронированный на оригинальном танке, а тут все в одном месте.Огромные съемные топливные баки крепятся к задней части бака, а также присутствует большая толстая задняя пластина бака.
Поскольку эти боковые юбки на самом деле нельзя было снять без тяжелой рабочей установки или кранов для их снятия. Конечно, они не были гибкими или сгибаемыми, как тонкие бронированные юбки, скажем, на пантере или PZ.IV. Снова присутствует сталь с ямками на этих пластинах и репликация сварки на стыках, приятно видеть здесь только правильные детали.
Защита перед люком механика-водителя есть здесь, на версии V2 этого танка, заметили сварные швы?
На задней пластине можно увидеть эффект ямчатой ​​​​стальной прокатки. Сварочные швы снова присутствуют. Два больших резервуара поставляются пополам по центру. К сожалению, вам придется очень осторожно снимать их с литников.
Литник U — Последний литник содержит несколько деталей, на которые люди действительно будут обращать внимание, длинный 128-мм ствол орудия, маску орудия и несколько других внутренних и меньших областей, требующих внимания, а также переднюю палубу корпуса и погон башни. .
Передняя палуба и лобовая плита снова дают нам некоторые реплики катаной стали на поверхностях, действительно впечатляющие, а также открытая или закрытая ниша для люка водителя.
Маска, если большая кошачья часть на настоящей вещи, и здесь опять же, литая поверхность великолепна. Болты имеют острые кромки, а на маске много сложных углов, а маленькое (пистолетное) орудие здесь, на литнике.
Основное вооружение 128мм пушки здесь — к сожалению, отлитое из двух половин, требуется тонкая склейка, кому-то подойдет металлическое орудие, но если быть аккуратным, то получится приличная стрела.
Я заметил, что последние несколько дюймов (здесь мм) внутри пистолета имеют эффект нарезов — не многие это заметят, но это признак того, что производители комплекта заботятся о конечном продукте.
Самая большая часть этого комплекта — нижняя часть корпуса. Все это сидит на этом, и хотя многое из этого невидимо, это основа этого массивного танка. Он не маленький — и он как бы изогнут. Хотя в основном это незаметно, когда комплект готов.

Головки для передних колес хорошо помогают правильно разместить

…как и задняя часть корпуса — расположение легко благодаря имеющимся здесь слотам. Снова сварка швов и стальной прокат здесь в пластичном виде.

Последнее и не менее важное — это действительно большая разница между этой и другой версией Maus takom — башня. Два верхних люка можно открыть через крышки люков, которые выдвигаются на решетку. Задний пистолетный порт также можно оставить открытым. Но салона нет, так что лучше поставить туда танкер!

Угловые щеки видны спереди на аспекте.

Здесь снова виден обратный вид верха башни, сварных швов и фактуры стали.

Крупный план задней части башни показывает эти детали при более близком рассмотрении.

Вот он — самый большой танк, который большинство из нас сделает в 35-м масштабе. Простой в изготовлении, и хотя на начальных этапах сборки это немного повторяется, это не больно в тех частях, которые вам нужно сделать, что приятно.

Набор «Дракон» нуждался в обновлении, и хотя этот набор все еще в порядке, этот набор проще и, на мой взгляд, имеет лучшую детализацию поверхности, чем тот набор. что касается грядущего комплекта Trumpeter с интерьером — ну, мне это кажется немного сомнительным, так как нет реальной ссылки, и бак такого размера с полным интерьером — это будет МНОГО работы — этот комплект достаточно работы для меня.Он уже наполовину сделан на моем стенде — руководство по сборке придет на следующей неделе.

Адам Норенберг

Спасибо Takom за то, что прислали нам этот комплект для обзора и сборки. Следите за новостями здесь по адресу TMN или на веб-сайте Takom для второй части обзора — сборка будет очень скоро.


В сознании мышей и людей

Технологии мониторинга и генная инженерия создают все больше моделей психических расстройств у животных, но исследователи все еще учатся тому, как их лучше всего использовать.

Любой, кто знаком с синдромом Ретта, узнает симптомы. Мышиные модели — животные, несущие генетические мутации, подобные тем, которые вызывают заболевание у людей, — заламывают лапы, неуклюже ходят и плохо учатся. Другие заболевания головного мозга человека также имеют модели на животных. Мыши с дополнительными копиями участков генома, продублированных при синдроме Дауна, демонстрируют проблемы с моторикой и дефицит обучения.Нарушение развития, известное как синдром ломкой Х-хромосомы, возникает, когда у людей отсутствует рабочая копия гена FMR1 ; мыши без гена демонстрируют дефицит обучения и гиперактивность, сходные с симптомами заболевания человека.

Не существует такой вещи, как аутичная крыса, но исследователи могут изучать психические состояния человека, анализируя поведение грызунов. Кредит: SAGE LABS

Но это состояния с дискретными, признанными причинами. Другие нейрокогнитивные расстройства, такие как аутизм, депрессия и шизофрения, имеют многочисленные и часто загадочные причины, поэтому имитировать их сложнее.Исследования выявили участие десятков генетических вариантов в возникновении расстройств, и факторы окружающей среды, от травматического жизненного опыта до внутриутробных состояний, также вносят свой вклад. Даже когда исследователи решили, какие гены или факторы изучать, не всегда ясно, как оценивать модели животных: как исследователь может использовать мышь для изучения болезней, диагностированных по галлюцинациям или неспособности понимать образный язык?

От поведения к биологии

Крейг Пауэлл, нейробиолог из Юго-Западного медицинского центра Техасского университета в Далласе, говорит, что целью модификации генов обычно является выявление механизмов заболевания. «Итак, вы создаете мышь с мутацией, которая, как вы знаете, вызывает аутизм у людей, и видите, что ее поведение напоминает аутизм», — говорит он. Следующий шаг Пауэлла — изучить срезы мозга мыши, чтобы увидеть, чем он отличается от обычных мышей.

В этот момент поведение может помочь исследователям сосредоточиться на том, что действительно важно. «Мы можем обнаружить сотни проблем с работой мозга, но только одна или две вызывают изменения в поведении, поэтому мы хотим исправить ситуацию и посмотреть, что изменяет поведение», — говорит Пауэлл.В работе, которая стала пробным камнем в этой области, Марк Беар, нейробиолог из Массачусетского технологического института (MIT) в Кембридже, и его коллеги показали, что снижение экспрессии определенного рецептора у мышей улучшает эффекты мутации, вызывающей ломкость. X-синдром 1 . Некоторые физиологические аномалии были обращены вспять, и у искусственных мышей было меньше судорог и лучшая память.

В другом примере Эдриан Бёрд, генетик из Центра клеточной биологии Wellcome Trust в Эдинбурге, Великобритания, и его коллеги обратили симптомы, напоминающие синдром Ретта, у мышей 2 . Они создали версию дефектного гена, нормальную активность которой можно было восстановить с помощью добавки к диете мыши, но вводили добавку только после того, как у мышей-носителей гена начали проявляться симптомы. Ожидалось, что активация гена в этот момент будет иметь небольшой эффект, но у мышей наблюдалось заметное улучшение, что дает надежду на то, что выздоровление возможно и у людей. Аналогичное исследование 3 спинальной мышечной атрофии показало, что восстановление функции дефектного гена через четыре дня после рождения практически устраняет признаки болезни; Делая это через десять дней после рождения, мало что удавалось.Такие исследования могут помочь исследователям предсказать, какие пациенты, скорее всего, выиграют в клинических испытаниях.

Менее беспокойные мыши проводят больше времени на открытом пространстве. Авторы и права: C. TOUMA/MAX PLANCK INST. ПСИХ.

Исследования поведения также могут помочь выяснить, как генетические варианты взаимодействуют друг с другом и с факторами окружающей среды. В одном исследовании, опубликованном в этом году 4 , самцы дикого типа из пяти линий мышей были скрещены с самками, несущими мутацию, вызывающую симптомы, напоминающие аутизм, и нарушения развития.Тесты на потомстве показали, что симптоматическое поведение повторялось только в некоторых генетических фонах. В другом исследовании 5 мышей из линии, демонстрирующей ряд симптомов, связанных с аутизмом, выращивали вместе с мышами из линии, известной своей высокой общительностью. У выращенных мышей во взрослом возрасте не было никаких социальных дефицитов, но другие соответствующие симптомы, такие как повторяющийся уход, не уменьшились. И когда мутантная версия DISC1 , первого гена, связанного с шизофренией, присутствует у мышей, чья иммунная система матери подвергалась стрессу во время беременности, у потомства проявляются симптомы аффективных расстройств и аутизма 6 .Без стрессоров окружающей среды у них проявляются симптомы шизофрении.

Видеозапись различных линий мышей (обозначенных) показывает, что некоторые исследуют новую клетку больше, чем другие. Авторы и права: B. SPRUIJT/DELTA PHONOMICS

Даже самые умные анализы не могут уловить некоторые важные аспекты человеческих болезней, такие как параноидальный бред, распространенный при шизофрении. (На самом деле, поскольку модели всегда будут несовершенными, большинство исследователей поведения возражают против таких фраз, как «мыши-шизофреники».) Михаил Плетников, нейробихевиоролог из Университета Джона Хопкинса в Балтиморе, штат Мэриленд, является одним из многих ученых, надеющихся дополнить поведенческие тесты более легко измеряемыми биомаркерами. Люди с шизофренией демонстрируют широкий спектр поведенческих симптомов, но их боковые желудочки — заполненные жидкостью полости по обеим сторонам мозга — имеют тенденцию быть больше, чем в среднем, поэтому Плетников использует сканирование мозга для измерения этих структур у мышей. Он говорит, что не всегда необходимо видеть изменения в поведении, чтобы исследовать биологию болезни.«Со смирением вы можете использовать мышей, крыс или даже червей».

Дуглас Уолстен: «Если есть сомнения, экспериментатор должен посмотреть, что делает животное».

Неожиданное поведение выявило непредвиденную биологию. Несколько лет назад Гопин Фэн, нейробиолог из Массачусетского технологического института, пытался выяснить функцию различных белков, обнаруженных по обе стороны от синапсов, соединяющих нейроны. Отключение одного из таких белков, SAPAP3, не оказало заметного влияния на функцию мозга: мыши ходили и учились нормально 7 .Однако у них, похоже, было что-то не так с кожей: на их лицах появились открытые язвы. После того, как тесты не показали ничего необычного, видеонаблюдение показало, что мыши чрезмерно ухаживали за собой, буквально протирая шерсть. Дальнейшая работа показала аномалии в области мозга, связанные с обсессивно-компульсивным расстройством (ОКР). Хотя SAPAP3 ранее не был связан с этим состоянием, лекарства, которые облегчали симптомы ОКР у людей, уменьшали уход за мышами. Исследования 8 белков, которые взаимодействуют с SAPAP3, показали, что они тоже связаны с обсессивно-компульсивным расстройством и аутизмом.

По мере того, как генетические исследования человека выявляют варианты генов со все меньшим влиянием на болезни, растет потребность в новых поведенческих тестах для их оценки. Результаты анализов сильно различаются, и они могут не измерять наиболее значимые симптомы, говорит Джеффри Могил, нейробиолог из Университета Макгилла в Монреале, Канада. «Мы добились большого прогресса в создании все более привлекательных мышей, но, в конце концов, вопрос в том, каков ваш анализ и какова ваша мера, и актуальны ли они?» он говорит.«Медленным звеном в цепи, беспорядочным звеном в цепи всегда были поведенческие анализы».

Текущие тесты поведения животных — это тупые инструменты. Задача Морриса на водную навигацию оценивает когнитивные способности животного, оценивая, как оно учится использовать пространственные сигналы, чтобы плыть к подводной платформе, которую оно не может видеть. Изменения в производительности животного можно использовать для измерения обучения и памяти. Тесты на тревожность включают тест открытого поля, который измеряет время, которое мышь проводит в замкнутом пространстве или вдоль краев своей клетки; нервные животные избегают открытых участков. В обоих случаях психиатрические препараты, эффективные для людей, изменяют результаты.

Такие тесты могут быть эффективными при скрининге новых лекарств, которые действуют по тому же механизму, что и существующие. Но они менее полезны для состояний, при которых не существует эффективных лекарств, или для понимания патологии. Поэтому исследователи пытаются разработать тесты, которые фиксируют более специфические компоненты человеческих расстройств.

Жаклин Кроули: «Модель животного не может быть переведена на 100%, но, возможно, 80% будет достаточно.

«Мы больше общаемся с клиническими исследователями, — говорит Жаклин Кроули, руководитель отдела поведенческой неврологии в Национальном институте психического здоровья США в Бетесде, штат Мэриленд. как выглядят болезни, какова их изменчивость в реальном мире и что вы считаете основными основными симптомами?»

Собственные исследования Кроули детей с аутизмом вдохновили ее на разработку теста аналогичного поведения на мышах. группа детей без аутизма играет вместе, а дети с аутизмом в стороне играют с поездом или компьютером», — вспоминает она.Поэтому Кроули разработал задачу, которая оценивала, предпочитает ли мышь проводить время с социальным партнером или с неодушевленным предметом. В настоящее время этот анализ используется во многих лабораториях.

Клинические испытания вдохновили других животных. Могил и его коллеги разработали шкалу мышиной гримасы для оценки боли 9 , основанную на шкале, которая использовала выражение лица для определения боли у младенцев и других людей, неспособных говорить. Могил считает, что его шкала окажется более надежным показателем хронической боли, чем обычно используемые тесты, такие как тест отдергивания хвоста, который измеряет, насколько быстро мышь убирает хвост из луча света.Это также должно помочь исследователям в разработке более гуманных экспериментов. Другие ученые разработали мышиную версию 10 Висконсинского теста сортировки карточек, в котором участникам предъявляют карточки, на которых изображены, скажем, три красных круга или четыре синих квадрата. Как только люди осознают, что вознаграждение приходит, скажем, за сопоставление карт по цвету, критерии вознаграждения меняются на сопоставление по форме или номеру. Тест используется для изучения расстройств, включая аутизм и шизофрению. Версия для мыши основана на таких ароматах, как корица и чеснок, а также на текстурах, таких как гравий и ватные шарики.Фэн в настоящее время оценивает анализ на мышиных моделях аутизма.

Тим Басси и Лиза Саксида, нейробиологи из Кембриджского университета, Великобритания, разработали версию интерфейса с сенсорным экраном для мыши, первоначально разработанного для людей и приматов. Он использует высококонтрастные изображения, адаптированные к зрению мыши; и вместо того, чтобы нажимать на рычаг или совать нос в дыру в стене, как в большинстве систем для тестирования мышей, животное касается экрана носом или лапой. Технология, коммерциализированная Campden Instruments в Лафборо, Великобритания, в прошлом году, может оценить многие когнитивные способности грызунов; одна группа тестов оценивает функции, обычно нарушенные у пациентов с шизофренией, включая зрительное восприятие, рабочую память и заучивание образов 11 . По оценкам Басси, система сейчас используется более чем в 30 лабораториях.

Вмешивающиеся переменные — проклятие поведенческого тестирования, говорит Дуглас Уолстен, нейробиолог из Университета Северной Каролины в Гринсборо и автор справочника по этой теме. Например, если мышь охвачена страхом и стоит неподвижно в центре открытой камеры, то время, которое она там проводит, может быть ошибочно истолковано как демонстрация снижения тревожности. А стены резервуаров с водными лабиринтами часто настолько высоки над водой, что мыши не могут видеть большую часть комнаты, что затрудняет им поиск платформы с помощью пространственных ориентиров.

Генетическая манипуляция увеличивает количество артефактов в данных, потому что манипуляции с генами могут изменить то, как мыши выполняют задачи по причинам, которые не имеют ничего общего с тестируемыми параметрами (см. «Оценка анализов»). Если оценки обучения основаны на способности животных ассоциировать звук с легким электрическим током, например, исследователи должны убедиться, что у животных нормальный слух и чувствительность к боли. Самой большой смешанной переменной может быть просто перемещение мыши из клетки в область, где проводятся тесты.«Очень редко бывает, чтобы маленький грызун был поднят другим животным и выжил», — говорит Лоуренс Текотт, нейробиолог из Калифорнийского университета в Сан-Франциско. «Мы пугаем животное до чертиков, а затем спрашиваем его, беспокоится ли оно и как оно может учиться», — говорит он. «Мы делаем это регулярно».

Чтобы уменьшить стресс, исследователи работают над тем, чтобы не только наблюдать за поведением животных, но и делать это без предварительной физической транспортировки животных. В IntelliCage, системе наблюдения от NewBehavior в Цюрихе, Швейцария, каждое животное чипировано.Система следит за тем, когда каждое животное пьет и ест, а также за тем, как оно ведет себя на разных станциях в своем вольере.

Цвета мышей и их подстилок могут сбить с толку системы видеонаблюдения. Фото: Д. ВАЛЬСТЕН/UNIV. СЕВЕРНАЯ КАРОЛИНА GREENSBORO

Компания Tecott совместно с коллегами Эваном Гулдингом и Катрин Шенк разработала недорогую систему круглосуточного наблюдения за животными 12 . Клетка стоит на платформе для определения веса, которая измеряет местоположение животного 50 раз в секунду.Самокорректирующаяся информатика организует движения животного в «приступы» активности и может отслеживать мышь, когда она ест, испражняется и перемещает подстилку. В рамках проекта Mouse Phenome, международного сотрудничества по сбору фенотипических данных о штаммах мышей, используемых в лабораториях, Tecott разрабатывает базу данных об образе жизни для 16 штаммов. Даже по предварительным результатам штаммы можно отличить по характеру их активности.

Текотт также использовал свою систему мониторинга на двух линиях мышей, генетически модифицированных для ожирения: мыши ob / ob , у которых отсутствует ген, вырабатывающий один из гормонов, регулирующих аппетит; и мутантные мыши htr2c , у которых отсутствует рецептор нейротрансмиттера серотонина 12 .По словам Текотта, мыши ведут себя как домоседы и полуночные перекусы соответственно. Животные ob / ob едят лишь немногим больше, чем мыши с нормальным весом, но проводят примерно в пять раз меньше времени, прогуливаясь по клеткам. Мутанты htr2c имеют нормальную активность и питаются большую часть времени, но покидают свои норы в середине периодов отдыха для серии закусок. Без автоматизированного анализа такое понимание поведенческих компонентов ожирения было бы трудно обнаружить.

Более дорогие системы видеослежения, которые уже широко используются для многих поведенческих тестов, также могут использоваться для наблюдения за животными в их домашних клетках, автоматически обнаруживая и классифицируя поведение. По словам Лукаса Нолдуса, исполнительного директора Noldus Information Technology в Вагенингене, Нидерланды, по мере того, как все больше молекулярных биологов хотят отслеживать генетически модифицированных мышей, спрос на автоматизированные системы и их применение растут. Нолдус описывает одну из последних систем своей компании как «домашнюю клетку с инструментами, которую можно настроить различными способами, от очень пустой клетки до очень богатых стимулов.В зависимости от конфигурации клетки вы можете проводить всевозможные тесты: тест на тревогу со световым пятном или тест на память с автоматическим дозатором гранул».

Мыши (слева) обычно используются в качестве моделей заболеваний, но крысы имеют более сложное и общительное поведение, поэтому они лучше подходят для моделирования нейрокогнитивных расстройств. Предоставлено: SAGE LABS

Компонент мониторинга не мешает животному, говорит Викрант Кобла, вице-президент по развитию бизнеса Clever Sys в Рестоне, штат Вирджиния.«Вы берете ту же клетку и ставите перед ней камеру». Системы его компании распознают более двух десятков видов поведения, включая кивание головой, уход за собой и вставание на задние лапы, и этот репертуар расширяется. «У нас так много модулей, которые мы разработали, что мы можем адаптировать их для работы с новыми моделями поведения», — говорит Кобла.

«Если вам нужны детальные измерения из многих видов тестов, вам действительно нужно использовать отслеживание видео», — говорит Уолстен. Тем не менее, говорит он, точность нельзя считать само собой разумеющейся даже для стандартных тестов поведения животных. Выследить сразу двух животных особенно сложно. Например, программное обеспечение нередко путает нос животного с его хвостом. Плохое освещение мешает многим экспериментам, особенно если мышь перемещается из более светлой области в более темную, а у белых, коричневых, черных и пятнистых мышей возникают различные артефакты. Инфракрасная подсветка значительно уменьшает эти проблемы и доступна в продаже, но редко используется как из-за недостаточной осведомленности, так и из-за стоимости переоборудования существующего оборудования.Но даже самые лучшие системы требуют значительных усилий, чтобы избежать ложных показаний, предупреждает Пауэлл. «Даже в книге трудно описать все подводные камни, — говорит он. «Не берите таблицу Excel в конце и не анализируйте ее. Следите за тем, что происходит во время эксперимента».

Даже когда за поведением можно наблюдать точно, активность мыши может быть недостаточно надежной или тонкой, чтобы отражать эффекты изменения гена или окружающей среды. Крысы демонстрируют более сложное поведение; например, однопометники борются друг с другом, поведение, которое считается социальной игрой. Наиболее известные поведенческие тесты были разработаны для крыс, поэтому многие исследователи заинтересованы в моделировании заболеваний с использованием генетически модифицированных крыс. Крысы, у которых отсутствуют гены, связанные с шизофренией, болезнью Паркинсона и аутизмом, являются одними из самых первых линий, производимых компанией Sigma-Aldrich в Сент-Луисе, штат Миссури, которая в начале этого года начала предлагать набор готовых нокаутированных крыс. Sigma и другие компании также берутся за индивидуальные проекты по генной инженерии крыс.

Системы видеонаблюдения анализируют поведение мышей в их домашних клетках.Программное обеспечение может фиксировать определенные действия, такие как уход и обнюхивание. Авторы и права: CLEVER SYS

Ричард Пэйлор, исследователь аутизма из Медицинского колледжа Бэйлора в Хьюстоне, штат Техас, только что приступил к испытаниям нокаутированных крыс, изучая поведение, например, то, как крысы взаимодействуют и издают звуки в социальных ситуациях, а также то, как они реагируют на социальные ситуации. запахи. Он надеется сообщить о результатах к концу года. По его словам, еще слишком рано говорить что-либо определенное, но крысы должны позволять более точную оценку поведения, чем мыши.В частности, их можно использовать для количественной оценки эффектов потенциальных методов лечения социальных и коммуникативных расстройств, что оказалось особенно трудным для мышей. Большой размер крыс также облегчает получение электрофизиологических записей, изображений мозга и образцов тканей.

Пэйлор предсказывает, что лабораториям, работающим с мышами, будет трудно перейти на крыс, которых дорого покупать и содержать, им нужно больше места и другое оборудование. «Мы будем своего рода тестовым случаем для лабораторий, которые, возможно, захотят изучать как мышей, так и крыс», — говорит Шеннон Гамильтон, постдоктор в лаборатории Пейлора.

Но независимо от того, тестируют ли они крыс или мышей, говорит Кроули, исследователи должны помнить, что цель животной модели — не совершенство, а полезность. «Животная модель не может быть переведена на 100%, но, возможно, 80% достаточно для проверки возможных методов лечения».

Вставка 1: Оценка анализов

Исследователи, оценивающие модели на животных, рассматривают три вида валидности.

Конструктивная валидность означает, что тест измеряет то, на что он претендует. В моделях на животных это означает, что все, что вызывает симптомы у животного, также способствует заболеванию у людей.Такой достоверности относительно легко достичь, когда состояние вызвано одним геном, но большинство из них сложнее. Михаил Плетников, нейробиолог из Университета Джона Хопкинса в Балтиморе, штат Мэриленд, моделирует шизофрению, комбинируя гены и стрессоры окружающей среды. Он говорит, что для сложных расстройств «мы прошли тот период, когда мы манипулируем одним геном, чтобы попытаться понять всю болезнь».

Лицевая валидность означает, что тест, по-видимому, измеряет то, что ему нужно, например, что симптомы на животной модели отражают симптомы у человека. Для частоты сердечных сокращений или роста опухоли такие измерения могут быть простыми, но для заболеваний, оцениваемых по поведению, это значительно сложнее. Мыши BTBR, штамм, используемый для изучения аутизма, избегают взаимодействия с другими мышами и чрезмерно ухаживают за собой. Когда самцы BTBR подвергаются воздействию женской мочи, они не издают звуков и не пахнут, как это делают самцы других штаммов. Эти и другие черты хорошо совпадают с диагностическими критериями аутизма у людей, которые включают дефицит взаимодействия и общения, а также повторяющееся поведение.

Прогностическая валидность — это степень, в которой тест предсказывает будущий результат. В животной модели животное должно реагировать на лекарства так же, как и у человека. Например, антидепрессанты иногда оценивают по их влиянию на тест принудительного плавания, который измеряет, как долго мышь будет пытаться выбраться из резервуара с водой, прежде чем сдаться. Однако для таких расстройств, как аутизм, не существует эффективных лекарств, которые могли бы служить положительным контролем. Даже если наркотики существуют, симптомы или механизмы, зафиксированные одним поведенческим анализом, вряд ли охватят все, что важно. М.Б.

Ссылки

  1. Krueger, D.D. & Bear, M.F. Annu. преподобный мед. 62 , 411–429 (2011).

    КАС Статья Google ученый

  2. Гай, Дж., Ган, Дж., Селфридж, Дж., Кобб, С. и Берд, А. Science 315 , 1143–1147 (2007).

    ОБЪЯВЛЕНИЕ КАС Статья Google ученый

  3. Лутц, К.М. и др. Дж. Клин. Вкладывать деньги. (в печати).

  4. Spencer, C.M. et al. Аутизм Res. 4 , 40–56 (2011).

    Артикул Google ученый

  5. Ян М., Перри К., Вебер М. Д., Кац А. М. и Кроули Дж. Н. Autism Res. 4 , 17–27 (2011).

    Артикул Google ученый

  6. Абазян Б.и другие. Биол. Психиатрия 68 , 1172–1181 (2010).

    КАС Статья Google ученый

  7. Welch, J.M. et al. Природа 448 , 894–900 (2007).

    ОБЪЯВЛЕНИЕ КАС Статья Google ученый

  8. Peça, J. et al. Природа 472 , 437–442 (2011).

    ОБЪЯВЛЕНИЕ Статья Google ученый

  9. Лэнгфорд, Д.Дж. и др. Природный мет. 7 , 447–449 (2010).

    КАС Статья Google ученый

  10. Bissonette, G.B. et al. J. Neurosci. 28 , 11124–11130 (2008).

    КАС Статья Google ученый

  11. Bussey, T. J. et al. Нейрофармакология doi:10.1016/j.neuropharm.2011.04.011 (2011).

  12. Гулдинг Э.Х. и др. Проц. Натл акад. науч. США 105 , 20575–20582 (2008 г.).

    ОБЪЯВЛЕНИЕ КАС Статья Google ученый

Ссылки на скачивание

Информация об авторе

Принадлежности

  1. Моня Бейкер — технологический редактор журнала Nature and Nature Methods.

    Monya Baker

Об этой статье

Цитировать эту статью

Baker, M.В умах мышей и людей. Природа 475, 123–128 (2011). https://doi.org/10.1038/475123a

Загрузить цитату

Поделиться этой статьей

Любой, с кем вы поделитесь следующей ссылкой, сможет прочитать этот контент:

Получить ссылку для общего доступа

Извините, ссылка для общего доступа в настоящее время недоступна доступны для этой статьи.

Предоставлено инициативой Springer Nature SharedIt по обмену контентом.

Разведение и содержание мышей


Как обращаться с мышами?
Большинство видов мышей довольно послушны и не будут кусаться, если их не спровоцировать.Если мыши расстроятся, сделайте что-нибудь еще и вернитесь к ним после того, как они успокоятся.

Пересадка мышей из клетки в клетку. Осторожно возьмите мышь за хвост рукой в ​​перчатке. Схватив мышь за основание хвоста, вы получите больший контроль. Бесхвостых мышей можно схватить за шкирку. Расслабьтесь и осторожно обращайтесь с мышами. В большинстве случаев, если вы расслаблены, если мышь попытается вас укусить, это будет нежный исследовательский укус, который не причинит вреда.Некоторые штаммы, особенно штаммы дикого происхождения, очень активны и могут создавать проблемы при обработке. С этими штаммами помогают длинные щипцы (Fisher 10-316C). Щипцы не следует использовать, если это не необходимо для защиты обработчика.

Проверка пробок, проверка мышей. Для проверки пробок и некоторых других наблюдений требуется чуть больше контроля над мышью. Перенесите мышь в верхнюю часть клетки с решеткой, идущей влево-вправо. Возьмите мышь за основание хвоста между большим и указательным пальцами и поместите остальные пальцы хватающей руки на крестец и поясничную область мыши.Когда вы схватите мышь, она оторвется от вас, положив передние лапы на перекладину клетки, что позволит вам осмотреть ее нижнюю часть.

Работа с мышами для маркировки, инъекций и введения через желудочный зонд. Полный контроль над мышью требуется для маркировки, инъекций и введения через желудочный зонд. Следующие инструкции приведут к тому, что мышь будет обездвижена в левой руке, а правая рука будет свободна. Поместите мышь на прутья клетки так, чтобы прутья двигались влево-вправо. Возьмитесь за хвост правой рукой, а затем левой рукой погладьте мышь. Правильная чистка мыши — залог успеха. Вы хотите обездвижить голову мыши, и для этого вся дряблая кожа вокруг задней части шеи должна быть содрана. Чтобы взять всю эту кожу в свои руки, начните царапающее движение низко на плечах мыши, большой палец с одной стороны, а указательный палец с другой. Кожа на задней части мыши может быть зажата между оставшимися пальцами и ладонью. Для зонда и инъекции тело мыши также необходимо обездвижить: растянуть тело мыши, осторожно потянув за хвост правой рукой и зацепив мизинец левой руки за хвост.Более подробное и подробное описание того, как выполнять желудочный зонд, приведено здесь.

    Если вы не ограничены работой с мышами в определенное время суток, вам может быть легче работать с мышами с утра до полудня. Мыши наиболее активны как раз перед тем, как гаснет свет, и часто с ними труднее справиться в конце дня.

Как отличить самцов от самок?
Расстояние между наружными половыми органами и анусом у самцов больше, чем у самок на всех постнатальных стадиях. Примерно после двухнедельного возраста соски самок обычно видны, а соски самцов — нет. У взрослых мошонка мужчины (и яички, если они вывернуты) являются очевидным маркером. Для несовершеннолетних сориентируйте клетку так, чтобы стержни шли слева направо, и поместите мышь на проволочную стойку клетки. Возьмитесь за хвост мыши между большим и указательным пальцами, а остальные пальцы положите на заднюю часть мыши и согните торец мыши к себе. Мышь будет пытаться оторваться от вас, используя прутья клетки.Легче всего определить пол новорожденных мышей, если область гениталий мыши полностью вытянута: возьмите мышей и слегка согните нижнюю часть спины, чтобы растянуть область гениталий. У пигментированных линий у новорожденных самцов мышей есть пигментное пятно над мошонкой. Примерно в двухнедельном возрасте соски самок мышей становятся более заметными, чем у самцов. Эмбрионы и плоды можно типировать с помощью ПЦР с праймерами SMCX-1 5’CCGCTGCCAAATTCTTTGG3′ и SMC4-1 5’TGAAGCTTTTGGCTTTGAG3′. Самки дают одну полосу, а самцы дают две полосы из-за различий в интронах между генами X и Y (Agulnik et al. 1997 Мамм. Genome 8, 134-138.) В качестве альтернативы праймеры Jarid 1c F CTGAAGCTTTTGGCTTTGAG и Jarid 1c R CCACTGCCAAATTCTTTGG амплифицируют полосу из 331 п.н. у самок, но две полосы из 302 и 331 п.н. у самцов: Clapcote SJ и Roder JC. Biotechniques 2005 38(5): 702. Симплексная ПЦР для определения пола у мышей. PMID: 15945368.

Как спаривать мышей?
     Если вы не спешите производить много потомства, поселите мышь-самца с одной или двумя мышами-самками. Мышей можно оставить вместе до тех пор, пока щенки не будут готовы к отлучению от груди, если в клетке не будет слишком тесно.Если вам нужны мыши преимущественно одного пола, вы можете удалить нежелательный пол через несколько дней после рождения (не беспокоить мам в течение первых суток после рождения). Остальные щенки будут расти быстрее. Тем не менее, вы должны знать, что самки являются лучшими матерями, если у них есть как минимум 3 детеныша, о которых нужно заботиться, поэтому не убивайте слишком сильно. Если вам нужно быстро размножить штамм, вы можете спаривать самок в течке с самцами каждый день и проверять пробки на следующее утро. Содержите самок с одинаковыми свиданиями вместе до отъема щенков.Для многих линий две беременные самки и их пометы могут содержаться вместе до отъема, хотя вы можете обнаружить, что особенно плодовитые линии, такие как CD1, требуют, чтобы клетка была разделена, чтобы избежать перенаселенности. Руководство IACUC для мышей с пометами ограничивает количество мышей до 2 взрослых и не более 20 детенышей.

Сколько длится беременность?
     Беременность составляет от 18 до 20 дней, в зависимости от штамма.

Как я могу предотвратить съедение матерями своих пометов?
     Мыши общительны и лучше заботятся о своих детенышах, когда живут с друзьями.Постоянно размещайте самок вместе с производителем, или беременных самок, или беременных самок вместе с небеременными самками. Однако не подсаживайте мышей в клетку всего за несколько дней до рождения, так как это будет их беспокоить. У матерей-новичков и очень молодых самок меньше шансов успешно вырастить потомство, чем у опытных матерей и более зрелых самок. Нельзя беспокоить матерей и их помет в первый день после рождения. Ко второму дню матери должны приобрести полноценное материнское поведение и лучше переносить срывы.Неблагоприятные условия окружающей среды, такие как внезапные громкие звуки и недостаточная вентиляция, также могут иметь пагубные последствия. Некоторые штаммы более материнские, чем другие (см. список характеристик штаммов Джакса). В трудных ситуациях вы можете перевести щенков в более материнскую породу или разместить беременную мышь материнской линии на той же или более поздней стадии беременности (с другим окрасом шерсти) вместе с вашей проблемной мамой. Вы можете держать под рукой одну или несколько клеток беспородных пар спаривания (например, мышей CD1 из Чарльз-Ривер) для выкармливания детенышей.Подробное описание того, как выращивать мышей, предоставленное лабораторией Джексона, доступно здесь. Кроме того, см. раздел ниже о повышении репродуктивной способности.

Когда следует отлучать мышей от груди?
     Мышей следует отлучать от груди через 3–4 недели после рождения. Щенков необходимо отлучать от груди, если та же мама рожает второй помет. Щенки должны быть крепкими, активными, иметь открытые глаза, зубы и взрослый мех, а не более редкий мех младенцев. Им нужно иметь возможность запрыгивать на верхнюю часть клетки, чтобы кормить и пить.Если они слишком незрелые, пусть дольше остаются с мамой. Во многих породах щенки, готовые к отлучению от груди, будут «попкорн», когда крышка клетки открыта. Если вы не уверены в их способности выздоравливать самостоятельно, вы можете оставить немного размягченного водой корма на дне клетки, чтобы помочь им пережить первые день или два.

Когда мыши становятся половозрелыми?
     Самки мышей становятся половозрелыми через 6 недель после рождения, а самцы — через 8 недель.

Какие допустимы методы эвтаназии?
     Мышей наркотизируют путем вдыхания CO 2 , а затем усыпляют путем смещения шейных позвонков.Хотя только CO 2 может привести к эвтаназии животных, необходимо установить, погибли ли животные (см. рекомендации NIH по использованию только CO 2 ), поэтому после использования CO 2 рекомендуется смещение шейки матки. CO 2 должен поставляться из резервуара , а не из сухого льда. ARC предоставляет резервуары и камеры. Дайте газу течь в течение 1 минуты, чтобы заполнить камеру, и оставьте камеру закрытой на 5 минут. Наркотизация мышей происходит быстро, поэтому не оставляйте камеру без присмотра.Смерть должна быть обеспечена вывихом шейки матки. В различных учреждениях CWRU мышей можно оставить на стеллажах в специально отведенной комнате для эвтаназии персоналом ARC. Мыши не должны быть переполнены, и у них должно быть достаточно еды и воды, чтобы продержаться в течение рабочего дня следующего рабочего дня. Если неотъемные щенки остаются без матери, необходимо немедленно уведомить об этом ARC, чтобы можно было без промедления провести эвтаназию.

    CO 2 для эвтаназии дешев, удобен, эффективен и представляет небольшой риск для персонала и исследователей, но гуманность его использования вызывает все больше споров. Альтернативный метод эвтаназии заключается в анестезии мышей изофлюраном перед смещением шейки матки. В химическом вытяжном шкафу (т. е. во взрывозащищенном колпаке с вентиляцией наружу) наденьте колпачок, наполненный изофлураном, на ткани на дне небольшой камеры (пустая пластиковая коробка для наконечников пипеток для эвтаназии одиночных мышей), поместите мышь внутрь и закройте камеру. Когда мышь неподвижна, откройте камеру и выполните смещение шейки матки. Имейте в виду, что изофлуран представляет опасность для здоровья, и следует избегать воздействия на персонал, ограничивая использование химическими вытяжными шкафами и аппаратами для анестезии, а также надлежащим хранением.

    Мыши могут быть подвергнуты эвтаназии путем смещения шейных позвонков без анестезии опытными компетентными лицами, если это научно обосновано. IACUC может потребовать демонстрации умения вывиха шейки матки. Вывих шейки матки производят, взяв мышь за основание хвоста. Мыши позволяют ухватиться за прутья поперечно ориентированной верхней части клетки, и при осторожном оттягивании хвоста назад основание черепа крепко захватывается между большим и указательным пальцами. Для обеспечения гуманной эвтаназии смещение шейки матки должно быть изучено под наблюдением квалифицированного специалиста.

Каковы приемлемые методы эвтаназии эмбрионов и новорожденных мышей?
     Новорожденных мышей можно наркотизировать в небольшом пластиковом пакете с СО 2 из газового баллона, пакет запаивают, затем мышей подвергают эвтаназии, помещая в морозильную камеру. Полные правила и рекомендации CWRU IACUC по допустимым методам эвтаназии плодных мышей (свыше 14 дней беременности), новорожденных мышей и молодых мышей доступны здесь.

Каковы приемлемые эффективные способы метки мышей?
     IACUC регулирует маркировку мышей. Прокалывание ушей (пробойники для ушей: Fisher 01-337B или Kent Scientific INS301202) можно проводить без анестезии. Наружные уши достаточно большие, чтобы протыкать уши после 2-недельного возраста. Тем не менее, удары по ушам могут стать трудными для чтения через несколько недель из-за заживления. Для более стойкой маркировки допустимо удаление последнего сустава пальца ноги без анестезии в течение первой недели после рождения. На каждой конечности можно обрезать только один палец. Анестезия должна использоваться для отсечения мышей старше одной недели. Необходимо предоставить научное обоснование использования подрезания пальцев вместо других методов идентификации. Полная политика CWRU IACUC по обрезке пальцев находится здесь. Татуировка является приемлемой альтернативой, хотя она используется реже. Тушью в шприце объемом 1 мл с иглой 30 калибра можно маркировать лапы в различных сочетаниях. В качестве альтернативы доступны коммерческие чернила для татуировки и устройства для татуировки (http://www.кетчум.ca). В некоторых случаях генотипы необходимы при рождении: на практике хорошо работает татуировка тушью новорождённых лапок с обрезанием хвоста. Мышей, в том числе новорожденных, можно пометить на несколько часов несмываемым маркером, однако чернила быстро удаляются мамами или при уходе, что делает пометку необходимой. Имплантированные идентификационные чипы-транспондеры являются альтернативой, если стоимость и трудозатраты не являются препятствием.


Как генотипируют мышей?
     Эффективный способ управления мышами – одновременное отлучение от них, прокалывание ушей и генотипирование.Генотипирование методом ПЦР является наиболее эффективным. В идеале праймеры ПЦР специфичны для мутации, а не общий набор, такой как праймеры для neo R или lacZ. Обширная информация о разработке и проверке анализов для генотипирования мышей доступна здесь. Здесь представлен простой и надежный протокол ПЦР из ушных проб. В качестве альтернативы Саузерн-блоты могут быть выполнены на ДНК пальцев ног, приготовленной описанным здесь методом.

Как содержать самцов и самок? Самцы не дерутся?
    Самки могут содержаться по пять в клетке и без проблем смешиваться с незнакомыми самками.Особое внимание необходимо уделить содержанию самцов из-за их склонности к дракам. Самцы, как правило, не будут драться, если их содержат вместе до наступления половой зрелости до старости. После половой зрелости самцы будут драться при знакомстве с новым самцом. Например, самцы, которых содержали в одиночестве, будут драться с любым представленным самцом. Таким образом, самцы из одного помета должны содержаться вместе с раннего возраста для экономии места. Самцов, используемых в качестве самцов-производителей, размещают по одному в клетке и никогда не помещают в клетку с другими самцами.Признаки драки между самцами проявляются в виде укушенных ран и могут привести к смерти. Самки, содержащиеся вместе, иногда не ладят, и это может проявляться в виде подстриженных до корня усов, других резко очерченных участков выпадения волос без кожных повреждений (стрижка) или укусов на спине и задних конечностях. Чаще всего это поведение можно устранить, поместив рассматриваемых самок в более низкую плотность или удалив доминирующую самку (ту, у которой все еще есть усы и нет укусов). Стрижка от легкой до умеренной может не требовать разделения, но заслуживает более пристального наблюдения в случае эскалации агрессии.

Что такое вилка?
     Вилки полезны для получения сопряжений по времени. Пробка представляет собой затвердевшую сперму, блокирующую влагалище и остающуюся на месте в течение примерно 12 часов после спаривания. Пробки обнаруживаются при визуальном осмотре или осторожном зондировании стерильной зубочисткой или тупым зондом (Fisher seeker 08-995) самки, иммобилизованной, как описано выше. Предполагается, что спаривание происходит в середине темного цикла (полночь при 12-часовом цикле включения/выключения, начиная с 6), и, таким образом, полдень следующего дня равен 0.5 дней беременности. Полное описание стадий эмбриогенеза мыши и развития плода см. в Hogan, B.L.M., Beddington, R., Costantini, F. and Lacy, E. (1994). «Манипулирование эмбрионом мыши. Лабораторное руководство». Пресса Колд-Спринг-Харбор.

Как определить, что у мыши течка?
    Самки мышей в течке готовы к спариванию. Выбирая самок в период течки, вы можете максимизировать размножение своих мышей или получить несколько самок, спариваемых одновременно. Вы должны ожидать, что в среднем от двух третей до трех четвертей мышей в течке будут спариваться. У самок в течке наблюдается отек губы вульвы, ближайшей к анусу. Возьмите самку за хвост в проксимальной трети и, удерживая большой и указательный пальцы за хвост, дайте мыши схватиться передними лапами за перекладину клетки и осторожно надавите остальными пальцами на поясницу и крестец, чтобы наклонить гениталии. анальная область вверх (лордотическое положение). Во время эструса вульва опухает, но влагалище не открывается.

     Цикл эструса составляет от 4 до 6 дней, поэтому в среднем примерно 1 из 5 самок должен находиться в течке в любое время, если самки чередуются случайным образом. Однако самки, постоянно содержащиеся вместе, могут циклировать вместе или могут выйти из цикла эструса. Молодые самки (от 6 до 8 недель) реже прекращают цикл. Воздействие мужских феромонов перезапустит цикл, как и изменение социальных групп среди женщин. Перенос подстилки из клетки половозрелого самца можно использовать для стимуляции цикличности.

Мои мыши не размножаются. Что можно сделать для стимулирования размножения?
    Мыши лучше размножаются, если им меньше восьми месяцев, поэтому следите за возрастом ваших мышей. Штаммы с пониженной фертильностью лучше всего размножаются, когда они молоды, но даже самые крепкие штаммы плохо размножаются после того, как им исполнится год. Знайте, чего ожидать от своего сорта: в этом отношении полезен список характеристик сорта Jax. Количество жира в рационе может иметь значительное влияние на плодовитость самок (чем больше жира, тем больше плодовитость), но повышенное содержание жира может отрицательно сказаться на производительности производителей.ARC может предоставить вашим мышам альтернативный корм с более высоким содержанием жира (стандартный рацион — Purina 5010, корм с низким содержанием жира; Purina 5021 — корм с высоким содержанием жира). Внезапные шумы могут оказать пагубное влияние на размножение, как и плохое качество воздуха. Уединение, обеспечиваемое «лачугами любви» (KLASS 4960 Almaden Expressway, Suite 233, Сан-Хосе, Калифорния 95118, США. Тел.: (408) 266-1235 скворечники для мышей MB-01) или гнездышками (VWR 10279-140) может помочь застенчивым штаммы. Цикл свет-темнота оказывает значительное влияние на воспроизводство мышей.Убедитесь, что ваши мыши находятся на соответствующем цикле (12 часов света, 12 часов темноты). В некоторых случаях увеличение светового периода (14 часов света и 10 часов темноты) может улучшить репродуктивный успех.

У моей мыши закрытые или увеличенные глаза, опухоли, алопеция или судороги: что не так?
    Мыши могут страдать от множества болезней. Спектр болезней зависит от штамма, условий содержания и множества других условий, но в приведенном выше коротком списке перечислены многие распространенные заболевания мышей.Тем не менее, часто обсуждайте здоровье ваших мышей с ветеринаром. Карточка отчета ARC о заболеваемости и смертности (MMR) может использоваться исследовательским персоналом для маркировки клетки с больной мышью для проведения осмотра животного ветеринаром ARC. Поместите заднюю печатную копию с логотипом ARC на клетку животного и доставьте две верхние копии в офис ветеринарного техника, EB12A.

Полезные ресурсы о здоровье мышей включают

Список инбредных линий мышей Лаборатории Джексона, в котором указывается восприимчивость различных линий мышей к болезням.

Руководство по оценке состояния и здоровья мышей, документ в формате pdf от Lab Animal.

Веб-сайт сравнительной патологии в Калифорнийском университете в Дэвисе

Веб-сайт Американского комитета по болезням лабораторных животных (ACLAD).

Должен ли я беспокоиться о генетическом фоне моих мутантных мышей?
Генетический фон может оказывать существенное влияние на мутантный фенотип. Для многих мутантов вам понадобится мутация хорошо охарактеризованного, надежного, распространенного инбредного штамма, такого как C57Bl/6.Мутация обычно скрещивается с фоном C57Bl/6 в течение 10 поколений, после чего она считается конгенной, поскольку ожидается, что геном будет на 99,8% состоять из C57Bl/6. (Подробная информация об ожидаемом содержании генома в каждом поколении обратного скрещивания доступна в книге Ли Сильвера «Генетика мышей», доступной онлайн в лаборатории Джексона). Мутация может быть продолжена для скрещивания с инбредным штаммом после этого момента. Мутанты, поддерживаемые скрещиванием между собой, могут привести к фиксации новых мутаций внутри штамма, и поэтому их следует избегать.На протяжении всей селекции нокаутные или трансгенные штаммы, генотипированные с помощью ПЦР, должны время от времени проверяться Саузерн-блоттингом, поскольку капризы ПЦР привели к тому, что более одной лаборатории потеряли мутант. Трансгенные штаммы часто необратимо теряют экспрессию трансгена из-за метилирования сайта вставки, поэтому разумно проверять трансгенные линии на экспрессию в каждом поколении. Криоконсервируйте свой штамм, если он не является одним из распространенных коммерчески доступных штаммов. Криоконсервация доступна в местных (Case Transgenic and Targeting Facility и коммерческих службах (Jax; Charles River). В некоторых случаях большая устойчивость и воспроизводимость аутбредного штамма, такого как CD1 (от Charles River), является достаточным преимуществом, чтобы компенсировать неоднородность фона, скажем, например, в исследованиях эмбриогенеза.

    Ряд штаммов, обычно используемых для получения трансгенных мышей, либо являются слепыми (FVB/NJ), либо выделяют ген слепоты (B6SJLF1/J и B6CBAF1/J). Слепота у этих линий вызвана рецессивной дегенерацией сетчатки при отлучении от груди из-за мутации Pde6b rd1 .Список затронутых штаммов и обсуждение того, как справиться с этой проблемой, находится здесь.

    Многие инбредные штаммы (включая C57BL/6J) имеют мутацию возрастной потери слуха 1 ( Ahl1 ), которая вызывает дегенерацию слуха, начинающуюся примерно в 10-месячном возрасте, в зависимости от генетического фона (Johnson et al., (2000) ) Геномика 70:171).

Насколько большую колонию мышей следует содержать?
Размер вашей мышиной колонии зависит от ваших потребностей. Учитывая затраты на содержание мышей, вы должны держать свою колонию как можно меньше. Для штаммов, которые вы в настоящее время не используете, достаточно небольшой племенной колонии из нескольких клеток (позволить ей спуститься в одну клетку — значит жить на пределе — не делайте этого). Мыши, которые не размножаются, — это тупик, поэтому убедитесь, что, если вы сократили свои запасы штамма до минимума, мыши плодовиты и молоды. Запланируйте разведение замещающих заводчиков, чтобы заводчиков можно было заменить, когда им исполнится от 6 до 8 месяцев.Криоконсервация мутантов и штаммов настоятельно рекомендуется для страховки от случайной потери. Структура племенной колонии будет зависеть от ваших потребностей. Для тех, кто нуждается в спариваниях по времени, необходим набор самцов-производителей, содержащихся индивидуально, и клетки с небеременными самками, размещенными по пять человек в клетке. Для поддержания запасов путем размножения пары для размножения (самец, самка и выводок) также обычно являются частью колонии. Хорошее обсуждение эффективных стратегий разведения для удовлетворения ваших потребностей дано в UC Irvine Transgenic Core.

Насколько обширными должны быть мои племенные записи? Что я должен отслеживать?
Ваши конкретные потребности будут определять уровень детализации, который вам потребуется в ваших племенных записях. Для больших колоний подробный учет может потребовать значительных ресурсов. Однако подробные записи необходимы для решения возникающих проблем. Записи могут храниться в лабораторных записных книжках и карточках клеток, в базах данных, созданных пользователями, в специально созданных коммерческих базах данных (Bigbench Mouse, программное обеспечение Progeny) или в бесплатных базах данных (Laboratory Animal Management System (LAMS)) или в База данных FileMaker с использованием шаблонов, предоставленных другим MouSeek Калеба Дэвиса, различные шаблоны базы данных FileMaker, созданные разными лабораториями.)

Как отправить/получить мышь?
Все мыши, которые должны быть получены в CWRU от учреждений, отличных от утвержденных коммерческих поставщиков, должны быть одобрены для получения ARC. Должна быть заполнена форма нестандартного поставщика (которую можно загрузить в виде файла в формате pdf здесь), должен быть представлен отчет о состоянии здоровья мышей, а ветеринарный врач CWRU ARC должен одобрить отправку. Отправка должна быть направлена ​​в приемный отдел Центра медицинских наук для животных. Объект После того, как ветеринар одобрит отправку, вам дадут адрес для получения.Ни при каких обстоятельствах нельзя получать мышей без предварительного согласования. В зависимости от патогенного статуса мышей они могут быть допущены к помещению в чистый или грязный карантин. Основным источником мышиных патогенов являются мыши, полученные от исследователей из других учреждений. Методы, используемые для мониторинга инфекционных агентов, относительно нечувствительны, и во время транспортировки мыши могут подвергаться воздействию патогенов. Наилучший способ гарантировать, что патогены не будут занесены, — это повторное получение входящего штамма.Состояние здоровья всех поступающих мышей не от коммерческих поставщиков проверяется ARC, и они принимают решение о необходимости повторной деривации или лечения перед выпуском из карантина. Редеривация мышей может быть выполнена Case Transgenic and Targeting Facility. Наиболее оперативным способом отправки и повторного получения является отправка замороженных эмбрионов или спермы или живых предимплантационных эмбрионов. Предимплантационные эмбрионы могут быть доставлены либо в криоконсервированном виде в жидком азоте, либо в виде бластоцист при комнатной температуре путем доставки в течение ночи.Свяжитесь с трансгенной службой по поводу криоконсервации и доставки замороженных эмбрионов или эмбрионов при комнатной температуре. В качестве альтернативы могут быть отправлены живые мыши. Транспортировочные контейнеры для мышей можно приобрести у Taconic и Zivic Miller. Еду и воду можно получить с помощью пакетов «Napa Nectar», которые можно приобрести в Lenderking. Следует знать, что отгрузка самок в первой трети беременности обычно заканчивается рассасыванием эмбрионов. При отправке помните о прогнозе погоды: вы не хотите отправлять в сильный холод или жару.Когда вы отправляете мышей в другие учреждения, они захотят узнать о состоянии здоровья ваших мышей и, вероятно, захотят связаться с ветеринарным персоналом ARC.

     ARC может помочь с доставкой мышей в другие учреждения (форма экспорта нестандартных поставщиков). (Некоторые учреждения принимают информацию о здоровье только от виварии, а не от отправляющего ИП.)

Как защитить мышей от патогенов?
     Существует несколько различных уровней контроля патогенов.Эти уровни варьируются от коммерческих операций, обеспечивающих аксеническое (стерильное) и гнотобиотическое (определенная флора) содержание, до бестимусных и ультрабарьерных помещений в CWRU, вентилируемых стеллажных систем Центра медицинских наук для животных и Центра мышей Wolstein, статических микроизоляторов до обычных клеток. . Большинство мышей в CWRU не содержат специфических патогенов. Процедуры, которым вы должны следовать, устанавливаются ARC и зависят от типа жилья. Однако во всех случаях можно соблюдать несколько общих правил.Следует учитывать, что мышиные возбудители будут наиболее распространены среди мышей, поэтому следует избегать контакта с мышами, которые являются потенциальными переносчиками возбудителя: дома не должно быть домашних грызунов; сбежавшие и дикие мыши в колониях должны быть немедленно отловлены; избегать контакта с мышами, которые, как известно, являются переносчиками патогенов.

Где получить дополнительную помощь.

UC Irvine University Transgenic Core содержит отличное руководство по разведению и размножению мышей

Базовое руководство по трансгенным трансгенам Мичиганского университета по разведению трансгенных и нокаутных мышей

В лаборатории Джексона есть Руководство по стратегиям разведения мышей (.pdf)

Мышь как модельная система, собранная нами информация о генетике и биологии мыши.

Центр CWRU ARC обеспечивает практическое обучение работе с микроизоляторами и работе с мышами.

Полезную информацию об истории и практической стороне генетики мышей можно найти в «Генетике мышей» Ли Сильвера, которая сейчас публикуется в Интернете Лабораторией Джексона.

Хоган Б.Л.М., Беддингтон Р., Костантини Ф. и Лейси Э. (1994). «Манипулирование эмбрионом мыши.Лабораторное руководство.» Cold Spring Harbour Press

Хетерингтон, М., Доу, Б. и Хэй, Д. (2000). Уход за мышами и содержание.